Overview

Brief Summary

Biology

The alligator snapping turtle is a solitary species, which mates in the early spring in Florida, later spring in the Mississippi Valley, and nests about 2 months later (8) (9). Nests are dug at least 50 m from the water's edge, into which a clutch containing anything between 8 and 52 eggs may be laid (9). Incubation lasts 100 to 140 days and most hatchlings emerge in September or October (8) (9). As with a number of reptiles, the sex of the young is determined by incubation temperature; high and low temperatures yield more females and moderate temperatures yield more males. Sexual maturity is attained between 11 and 13 years of age, and alligator snapping turtles have been known to live up to 70 years in captivity, although the lifespan in the wild is unknown (11). The alligator snapping turtle actively forages for food at night, but is more of a sit and wait predator during the day. The turtle lies quietly on the mud bottom with its jaws wide open, the dark colouring of its mouth-lining and exterior, which is coated in algae, making it almost invisible to fish (9). The worm-like lure within the turtle's mouth is wiggled to entice unwary fish and, when the unlucky fish comes close, the turtle's jaws are quickly snapped shut (6) (9). The alligator snapping turtle not only feeds on a variety of fish, but also on frogs, snakes, snails, worms, clams, crayfish, aquatic plants and even other turtles (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Amongst the largest freshwater turtles in the world, the alligator snapping turtle is a prehistoric-looking species with a reputation as the 'dinosaur of the turtle world' (2). Its camouflaged, ridged upper shell (carapace), large head, powerful, hooked, beak-like jaws, thick, scaled skin and oversized claws all contribute to this species' primitive look and set it apart from other freshwater turtles (4) (5). The three large, pronounced ridges running down the length of the dark brown to blackish shell somewhat resemble those on the back of an alligator, and earn the species its common name (2) (6). The shell also often has algae growing on it, which adds to the snapping turtles' camouflage (6). The tail is almost as long as the shell itself and, together with the chin, throat and neck, is coated with long, pointed tubercles (7) (8). The alligator snapping turtle has an unusual way of luring prey to it; the tongue contains a small, pink, worm-like projection (lure), which is grey at rest but suffused with blood when active, and wriggled to attract prey into the turtle's mouth (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

The Alligator Snapping Turtle is endemic to the US occurring in rivers that drain into the Gulf of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Macrochelys temminckii is found from northern Florida to southern Georgia and through the Gulf states into Texas. They are also found as far north as Illinois and Kansas. All stable populations are found around larger bodies of water such as the Mississippi River.

Biogeographic Regions: nearctic (Native )

  • Minton Jr., S. 2001. Amphibians & Reptiles Of Indiana. Indianapolis: Indiana Academy of Science.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Range is principally in the southeastern United States, in river systems that drain into the Gulf of Mexico (Lovich 1993), including virtually all rivers from southern Georgia (Johnson 1989, Jensen and Birkhead 2003) and northwestern Florida (see Pritchard 1992) west to Louisiana (Boundy and Kennedy 2006) and eastern Texas (San Antonio River), and extending north to southeastern Kansas, southeastern Iowa, Illinois, and southern Indiana (Conant and Collins 1991). This species is likely extirpated from Indiana and Iowa, and the Kansas records show no evidence of a viable breeding population. Breeding status in many areas is not well documented, so it is unclear whether occurrences of adults in an area indicate a resident nesting population or comprise individuals that have moved a short or long distance from the nearest nesting location. Nesting attempts have been noted in the northern part of the range (e.g., Figg 1991), but 1992 record of a 51-mm (carapace length) juvenile from Kentucky Lake, Tennessee, reportedly represents the first documented case of successful natural reproduction in any part of the range north of central Louisiana (Scott and Koon 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: North-America
Distribution: USA (Mississippi valley, Kansas, SE Iowa, Illinois, W Tennessee, W Kentucky, Missouri, Oklahoma, E Texas, Arkansas, Louisiana, Mississippi, Alabama, SW Georgia, N Florida)  
Type locality: "a tributary stream of the Mississippi, which enters that river above Memphis, in West Tennessee," U.S.A.; restricted to the Wolf River, Shelby County, Tennessee, USA., by Bour 1987.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to the southeastern region of the U.S., occurring in the river system that drains into the Gulf of Mexico (1) (2) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Alligator snapping turtles are the largest freshwater turtles in the world. They are characterized by three large, pronounced ridges that run from the front to the back of their carapace. They have powerful jaws, large heads, and are unique among snapping turtles for having eyes on the side of their heads. Alligator snapping turtles are primitive in appearance.

Range mass: 70 to 80 kg.

Range length: 79 to 101 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 66 cm

Weight: 68000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This species differs from the snapping turtle in its larger head, extra row of scutes along the sides of the shell, lack of a saw-toothed middorsal tail ridge, more lateral position of the eyes, and presence of a wormlike lure on the upper surface of the tongue.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Some natural habitat has been drained and replaced by agriculture in recent years, however, actual habitat loss, in terms of loss of rivers and their banks, may be small (Ewert 1997). The turtle has been found in reservoirs throughout their range and dyking of rivers to create winter waterfowl refuges has increased potential habitat in Arkansas and the lower Mississippi Valley and may offset some of the degraded habitat (Ewert 1997).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Alligator snapping turtles live in freshwater areas in the southeastern United States. They generally live in the deepest water within their habitat: large rivers, canals, lakes, swamps, and rivers. Hatchlings and juveniles usually live in smaller streams.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitat consists of slow-moving, deep water of rivers, sloughs, oxbows, and canals or lakes associated with rivers (e.g., large impoundments) (Ernst et al. 1994); also swamps, bayous, and ponds near rivers, and shallow creeks that are tributary to occupied rivers, sometimes including swift upland streams (Phelps 2004). This turtle sometimes enters brackish waters near river mouths. Usually it occurs in water with a mud bottom and some aquatic vegetation but may use sand-bottomed creeks (D. Jackson, pers. comm., 1992). Within streams, alligator snapping turtles may occur under or in logjams, beneath undercut banks, unde rock shelters, or in deep holes (Jensen et al. 2008). These turtles are highly aquatic and rarely are found out of water (except during nesting). In Tennessee, F. Scott (pers. comm., 1992) most often found radio-tagged turtles in less than 3 meters of water. In northeast Louisiana, Sloan and Taylor (1987) found that native turtles preferred flotant (dense floating vegetation mat) with cypress or buttonbush habitat. The turtles frequently used openings in the flotant beneath cypress trees. In the same region, Harrel et al. (1996) documented a preference for baldcypress forest by subadults; most occupied sites were associated with logs.

Ewert (1976) provided a description of nesting habitat. He observed 16 nests from the Apalachicola River, Florida, and one from Lake Iamonia which adjoins the Ochlockonee River, Florida. The turtles chose a variety of situations for nesting, from sand mounds along the river banks to sandbars within the stream, to a 1.5 m high steep cut bank. Conditions at the Apalachicola sites included xeric exposed sites (three nests), more mesic sites with trees nearby but open above (three nests), partially shaded sites (4 nests), and deeply shaded sites (six nests, one well within a three to five m cane stand with a completely closed canopy). Ewert suggested that many of the turtles emerged from quiet backwaters of the flooded forest, rather than the river proper. The Apalachicola nests' distance from the nearest water averaged 12 m. The one nest on an island in Lake Iamonia was in the open and was 72 m from the nearest water. Ewert and Jackson (1994) expanded this data set but not greatly altered these proportions. Jackson and Jensen (2003) reported nest sites that were about 30 and 70 m from streams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

A freshwater species generally found in the deep water of large rivers, canals, lakes and swamps, though hatchlings and juveniles usually live in small streams (9). These turtles seldom leave the water, with generally only nesting females venturing onto land, although males have been known to bask (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Females migrate short distances between aquatic habitat and terrestrial nesting areas (see global habitat comments).

These turtles generally have been regarded as rather sedentary but in fact they may make extensive movements. Sloan and Taylor (1987) studied movements for three months (August to November) of 11 radio-tagged turtles in northeastern Louisiana in a lake and impounded bayou. Six were native to the study site, and five were introduced, but no difference was found between introduced and native turtles in minimum home range or daily distance traveled. The native turtles all stayed within the lake or bayou where they were captured. Of the five introduced turtles, three moved between the lake and bayou. The range of daily travel distances for native turtles was 28 to 109 meters per day. Estimated minimum home range size was 18 to 196 hectares for natives. In the same region, Harrel et al. (1996) found that home range length in Louisiana averaged 3,495 meters in subadult males and 1,423 meters in subadult females.

In Arkansas, 11 PIT-tagged individuals moved both upstream and downstream with a maximum recorded distance of 1.8 kilometers (Trauth et al. 1998).

In Oklahoma, one individual moved upstream 27-30 kilometers in three years (Wickham 1922). Riedle et al. (2006) documented a movement of 16 kilometers in a two-month time period in Oklahoma. Shipman et al. (1991) recorded a 7-kilometer movement over five years in Kansas.

Pritchard (1978) hypothesized that individuals may move many kilometers over periods of many years, slowly migrating upstream for their whole lives, so that the upper reaches of rivers would have only older turtles. Others have disagreed with this hypothesis. Pritchard based his hypothesis on the fact that recent records in the farthest upstream locations have been large adults. An alternative explanation for this phenomenon is that such turtles represent remnants of populations that are no longer reproducing.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Alligator snapping turtles are both scavengers and active hunters. They are most active at night, during the day they lie quietly at the bottom of murky water and open their jaws to reveal their tongue, which looks like a small pink worm-like lure in the back of their gray mouth. The lure attracts fish, which are then either swallowed whole, sliced in two by their sharp jaws, or impaled on the sharp tips of the upper and lower jaws. Alligator snapping turtles most frequently feed on fish, molluscs and other turtles. In a Louisiana study turtles were found in the stomachs of 79.82% of all alligator snapping turtles. Macrochelys temminckii have been recorded eating frogs, snakes, snails, worms, clams, crayfish, insects and aquatic plants. They have even been known to eat medium-sized rodents, such as nutria (Myocastor coypus), squirrels, and muskrats (Ondatra zibethicus), and other medium-sized mammals, including opossums (Didelphis virginianus), raccoons (Procyon lotor), and armadillos (Dasypus novemcinctus). The main source of their diet, however, seems to be fish. These turtles feed year-round by taking advantage of warm winter days to search for food in the water and along the shoreline.

Animal Foods: birds; mammals; reptiles; fish; carrion ; insects; mollusks; aquatic crustaceans

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet includes various aquatic animals, vertebrate and invertebrate, carrion, and some plant material (Sloan et al. 1996). This is mainly a bottom feeder that sometimes uses an appendage on the tongue as a fish lure (most common in young).

See Tucker and Fitzsimmons (1992, Herpetol. Rev. 23:113-115) for information on a method of fecal analysis for determining diet.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Alligator snapping turtles are both major predators and opportunistic scavengers in their environment. These turtles can impact fish species as well as other turtle species due to their large food consumption, while also helping to clean up decaying organisms in their habitat.

Ecosystem Impact: biodegradation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The only known predators of adults are humans, but eggs and hatchlings are a source of food for large fish, raccoons, and birds.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: Number of occurrences has not been determined using standardized criteria; the number largely depends upon treatment of records within same river system. Nonetheless, even if occurrences encompass large areas, the species is represented by at least several dozen extant occurrences.

Pritchard (1989) showed more than 200 localities in at least 14 separate systems, and Trauth et al. (2004) mapped more than 100 collection localities in Arkansas alone, but the species no longer occurs in some of these historical locations. On the other hand, in southeastern Louisiana, 200 alligator snapping turtles were trapped in virtually all (32 of 33) surveyed sites, with no evidence of a significant decline in number of occurrences or area of occupancy (Boundy and Kennedy 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 100,000 individuals

Comments: Total adult population size is unknown but presumably is at least a few thousand and likely exceeds 10,000. Some Florida populations are still locally dense (D. Jackson, pers. obs.). Recent trapping surveys found that this species is still locally common in Spring Creek and tributaries of the Chattahoochee River (Apalachicola River drainage) in Georgia (Jensen and Birkhead 2003). Abundance and density are poorly known in most parts of the range. In two states where active research recently has occurred (Florida and Tennessee), researchers believe that the alligator snapping turtle is less rare than previously thought (D. Jackson, pers. obs.; F. Scott, pers. comm., 1992).

Judging from past harvest rates in Louisiana and Georgia (Johnson 1989), some populations historically must have been very large. One individual trapper legally harvested 4,000-5,000 adult M. temminckii from the Flint River and its tributaries between 1971 and 1983 (Johnson 1989). In Louisiana, alligator snappers ranged from 4% to 12.5% of all the turtles trapped in four locations (Cagle and Chaney 1950, cited in Ernst and Barbour 1972). The authors thought they may have under-sampled, because of techniques.

Floyd Scott (pers. comm., 1992) reported that in a recent 32-day trapping effort for alligator snappers in Kentucky Lake, Tennessee, he and J. Koons caught only two individuals out of 832 turtles (representing seven species) trapped (0.24%). A third individual was caught by a sport fisherman on a trotline.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Alligator snapping turtles are highly aquatic, emerging from water only for nesting or rarely, basking. Ewert (1976) reported the only known observation of basking. The turtle is secretive, a trait making it difficult to observe, and particularly difficult to find where it is also rare.

The principal predators of adults are humans. Nest predation likely takes a heavy toll.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Alligator snapping turtles use chemosensory cues to locate prey items. They use gular (throat) pumping to draw water in and out to sample the surrounding water for chemicals that have been released by prey species. Adult snapping turtles use this sensory system to hunt and locate mud and musk turtles (Kinosternidae) that have buried themselves into the mud bottom of a body of water.

Communication Channels: visual ; chemical

Perception Channels: visual ; chemical

  • Punzo, F., L. Alton. 2002. Evidence for the Use of Chemosensory Cues by the Alligator Snapping Turtle, Macroclemys temminckii, to Detect the Presence of Musk and; Mud Turtles. Florida Scientist, vol. 65/ no.2: 134-138.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Probably this turtle is inactive during cold periods in winter in the northern part of the range. Most activity apparently is nocturnal or crepuscular.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Alligator snapping turtle hatchlings look very similar to adults. Sex is determined by incubation temperature. Warm temperatures of 29 to 30 degrees Celsius produce 100% females, while slightly lower temperatures (25 to 27 degrees Celsius) yield predominantly males. All other temperatures allow both to develop.  Eggs are fertile if they have a clear subgerminal space or if a chalky white spot is on the eggshell.

Development - Life Cycle: temperature sex determination

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Males live from 11 to 45 years with an average age of 26 years. Females live from 15 to 37 years with an average of 23 years. Alligator snapping turtles can live a very long time in captivity; the oldest known individual in captivity was 70 years old.

Range lifespan

Status: wild:
11 to 45 years.

Range lifespan

Status: captivity:
70 (high) years.

Typical lifespan

Status: wild:
11 to 45 years.

Average lifespan

Status: captivity:
70.3 years.

  • Division of Scientific Authority United States Fish and Wildlife Service. The Alligator Snapping Turtle. 10-21-RR267-154. Aiken, SC: Savannah River Ecology Laboratory. 2007.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 70.3 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During mating, male alligator snapping turtles mount the back of the female. He grasps her shell with all four feet to inseminate.

Mating System: polygynandrous (promiscuous)

It is unlikely that females reproduce more than once a year, some females lay eggs on an alternate-year basis. These turtles mate in early spring in Florida and late spring in the Mississippi Valley. They lay eggs in a nest about two months later in a nest hole dug approximately 50 m from a body of water. All nests are dug in the sand and clutch success is highly variable. A clutch may contain 8 to 52 eggs and incubation takes 100 to 140 days. Hatchlings emerge in the fall. Sexual maturity is reached by both sexes at 11 to 13 years of age.

Breeding interval: Alligator snapping turtles breed once yearly.

Breeding season: These turtles mate in early spring in Florida and late spring in the Mississippi Valley.

Range number of offspring: 8 to 52.

Range gestation period: 100 to 140 days.

Range age at sexual or reproductive maturity (female): 11 to 13 years.

Range age at sexual or reproductive maturity (male): 11 to 13 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average number of offspring: 30.

Besides the act of mating, males invest no additional time or energy towards parenting. Once females dig a nest and lay eggs (9 to 52 per clutch), they invest no additional resources. Juvenile turtles are independent upon hatching.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating takes place from February to April in Florida, followed by nesting from late April through mid-May along the Apalachicola River (Pritchard 1978; Ewert and Jackson 1994). Oviposition apparently occurs from April through early May in Manchac, Louisiana, and from mid-May through early June near Jonesville, Louisiana (Dobie 1971). Nesting was observed in June in Butler County, Missouri (Figg 1991). Eggs number from 9 to 61 (average around 25-35) per nest, the number being related to the size of the female. Females produce only one clutch per year, and sometimes skip a year between clutches (Pritchard 1992). Eggs hatch in 11.5 to 16+ weeks. Hatching extends throughout August in northwestern Florida, where hatching success in protected nests was 66-78% over two years (Ewert and Jackson 1994). Maturity is reached at 11 to 13 years at the earliest (Dobie 1971, Pritchard 1978). The older, larger turtles may be disproportionately important in population maintenance.

Adults may live many years. One female found in Kansas was aged (by counting annuli on scutes) at 45 years (Shipman et al 1991). Captives have lived more than 70 years (Trauth et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Tongue lures fish: alligator snapping turtle
 

The tongue of an alligator snapping turtle aids fish capture via a worm-like lure.

   
  "An alligator snapping turtle lies in wait for a passing fish, well camouflaged against the muddy river bed. Like all turtles and tortoises, it has no teeth, but its jaws are covered in a sharp-edged horny beak suitable for shearing flesh. On the floor of its mouth is a fleshy pink worm-like lure, which the turtle waggles to attract fish. Eager to seize the 'worm', a fish may swim right in the turtle's gaping mouth." (Foy and Oxford Scientific Films 1982:142)

Watch video
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Jaws shear flesh: alligator snapping turtle
 

The powerful jaws of the alligator snapping turtle are effective at tearing flesh because they are covered in a sharp-edged horny beak.

   
  "An alligator snapping turtle lies in wait for a passing fish, well camouflaged against the muddy river bed. Like all turtles and tortoises, it has no teeth, but its jaws are covered in a sharp-edged horny beak suitable for shearing flesh. On the floor of its mouth is a fleshy pink worm-like lure, which the turtle waggles to attract fish. Eager to seize the 'worm', a fish may swim right in the turtle's gaping mouth." (Foy and Oxford Scientific Films 1982:142)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macrochelys temminckii

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC3736-07|NC_009260|Macrochelys temminckii| ACTCGCTGATTTTTTTCTACTAATCATAAAGACATCGGCACCTTATATCTAATTTTTGGCGCCTGAGCAGGAATAGTAGGCACAGCACTA---AGCTTATTAATTCGAGCAGAACTAAGTCAACCAGGTACCCTCCTGGGGGAT---GACCAAATTTATAATGTTATCGTTACAGCTCATGCCTTTATTATAATCTTTTTCATAGTAATACCTGTTATAATCGGGGGCTTTGGAAACTGACTTGTTCCATTAATA---ATTGGAGCACCAGACATAGCTTTCCCACGTATAAACAACATAAGCTTTTGACTTCTACCCCCATCTTTACTACTACTTCTAGCATCATCAGGAATTGAAGCAGGCGCAGGAACAGGTTGAACTGTGTACCCCCCACTAGCTGGAAATATAGCCCACGCTGGTGCCTCCGTAGATCTG---ACTATTTTTTCACTTCACTTAGCTGGAGTTTCTTCAATTCTAGGGGCCATCAATTTCATTACAACAGCTATTAATATAAAAGCACCAGCAATATCACAATATCAAACGCCTCTATTTGTATGATCAGTACTTATTACTGCTGTCCTATTATTACTTTCACTGCCTGTACTTGCTGCA---GGTATTACTATACTACTAACAGACCGAAACCTCAATACAACTTTCTTTGACCCATCAGGGGGAGGAGACCCAATTCTGTATCAACATTTATTTTGATTTTTTGGCCACCCTGAAGTATATATCCTCATCCTCCCAGGATTTGGTATAATCTCACATGTTGTCACCTACTATGCTGGTAAAAAA---GAACCATTCGGGTATATAGGCATAGTTTGAGCAATAATATCCATTGGATTCCTAGGCTTTATTGTATGAGCACACCACATATTTACTGTTGGCATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macrochelys temminckii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1cd

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Tortoise & Freshwater Turtle Specialist Group

Reviewer/s

Contributor/s

History
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Alligator snapping turtles are threatened by human exploitation in all U.S. states, but especially in Louisiana. In 1991 the U.S. Fish and Wildlife Services (USFWS) nominated alligator snapping turtles as a candidate to be placed on the Endangered Species list, but the USFWS later concluded in 1999 that they did not warrant protection under the Endangered Species Act. In 2004 the state of Louisiana put a ban on the commercial harvest of M. temminckii anywhere in the state.

US Federal List: no special status

CITES: appendix iii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Fairly large range in southeastern United States; has undergone a substantial decline in most of the range, due mainly to overharvest and habitat loss and degradation.

Intrinsic Vulnerability: Highly vulnerable

Comments: This turtle is vulnerable to exploitation, and once depleted, it may be slow to recover because of slow maturity and probable low recruitment.

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Other Considerations: The alligator snapper is a species of concern in every state within its range (Buhlmann and Gibbons 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2006 (1) and listed on Appendix III of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The species range is greater than 10,000 km² but population densities are likely to be low throughout this area (Ewert 1997), It is naturally rare in northern extremes of its range. Klemens and Behler (1997) report that there is good anecdotal evidence that the species is undergoing a long-term, non cyclical decline throughout much of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 50%

Comments: The species is thought to be declining throughout its range (Reed et al. 2002). The recent/current rate of decline is unknown but likely is less than it was a few decades ago and may be less than 50 percent over three generations (= several decades).

Global Long Term Trend: Decline of 30-50%

Comments: Direct information on population trend is limited, but loss and degradation of habitat in many historically occupied sites, and reductions in trapping success in remaining suitable habitat, indicate that a large decline in area of occupancy and abundance has occurred in most parts of the range (Pritchard 1989, Moler 1996, Heck 1998, Reed et al. 2002, Jensen and Birkhead 2003, Riedle et al. 2005, Shipman and Riedle 2008). Pritchard (1989) speculated that this turtle has declined (up to 95%) over much of its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The main threats include habitat alteration; exploitation by trappers for a large domestic market and a growing international market for its meat; pollution and pesticide accumulation (Holt and Tolson 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Ongoing threats include habitat alteration and fragmentation, water pollution, deliberate harvest for human consumption, and incidental catch by commercial fishers. Overharvesting and habitat alteration are the major threats (Reed et al. 2002, Riedle et al. 2005).

Commercial exploitation and other harvest for human consumption (and to a much lesser extent the pet trade) undoubtedly reduced populations of this species in much of its range (Pritchard 1992, Trauth et al. 1998, Reed et al. 2002, Riedle et al. 2005, Shipman and Riedle 2008). Commercial trappers harvested this species in large numbers in the 1970s and early 1980s to provide meat to soup canneries (Jensen et al. 2008). Arkansas may be one of the few remaining areas where overexploitation has not yet depleted the population beyond the possibility of natural recovery (Trauth et al. 1998), though Riedle et al. (in press) provided evidence that with the removal of harvest, populations of alligator snapping turtles in remaining suitable habitat in Missouri will recover over time. Commercial harvest is now illegal in most areas, but illegal harvest continues to some degree. Recently, three men were arrested in Florida for illegal possession of 33 alligator snapping turtles weighing more than 725 kilograms.

Unattended trotlines have, through inadvertent snagging of turtles, resulted in mortality in Missouri (Santhuff 1993). Jensen and Birkhead (2003) stated that mortality on set-lines and trotlines may inhibit recovery in Georgia.

Dams have blocked passage on many rivers, but it is unclear how effective dams may be in isolating populations and preventing gene exchange; populations can survive in impoundments. However, Riedle et al. (2005) noted a drastic decline of alligator snapping turtles in Oklahoma, due in part to thermal alteration by hypolimnetic releases from impoundments.

Water pollution and erosion associated with agriculture may have altered the food chain and otherwise degraded the habitat to the turtle's detriment in some areas (Heck 1998, Riedle et al. 2005).

Dredging river bottoms to maintain shipping channels likely destroys habitat, although the subsequent spoil may be utilized for nesting along certain rivers. Riedle et al. (2005) noted a drastic decline of alligator snapping turtles in Oklahoma, due in part to habitat degradation because of stream channelization. Jensen and Birkhead (2003) stated that stream dredging may inhibit recovery in Georgia. In southeastern Missouri, Shipman and Riedle (2008) found that most sites had been manipulated for channelization or drained and converted to agricultural fi elds.

Human disturbance may cause females to abandon nesting attempts; each re-nesting attempt increases exposure to predators.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

A major decline in numbers occurred as a result of over-collection by one of the major soup manufacturing companies in the U.S., and alligator snapping turtles are still threatened by over-harvesting for their meat in many areas of the U.S. (8) (12). Although some states now prohibit collection of this species, other states allow it with permits (13). Other threats to this turtle include habitat destruction and alteration, water pollution and pesticide accumulation (1) (9) (13).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Take is prohibited in Arkansas, Florida, Georgia, Indiana, Missouri, Tennessee, but allowed with the necessary permit in Alabama, Illinois, Kansas, Louisiana, Oklahoma and Texas.
It is listed on CITES Appendix III (United States of America).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: With adequate protection of habitat and enforced restrictions on harvest, restoration potential is high (D. Jackson, pers. comm., 1992; Riedle et al., in press). This turtle has relatively large clutches and adults are expected to survive for many years and to reproduce many times in the course of a lifetime. Monitoring nest predation and providing some protection may be necessary to allow a population to rebound from low numbers (D. Jackson, pers. comm., 1992). While captive breeding may be feasible (Capron 1987), it is probably unnecessary in most cases.

Preserve Selection and Design Considerations: Protection requires the preservation of occupied riverine habitat to maintain its ecological integrity. Preserves should not be negatively influenced by dams, pollution, or alterations of hydrology, stream course, or bank vegetation. Natural upland buffers large enough to accomodate undisturbed nesting should be included. At this time, minimum preserve size needed for viable populations is unknown.

Management Requirements: Ecological integrity of occupied river systems should be maintained, and river banks should be protected from disturbance. Protection from commercial collection and limits on personal collection are needed (Pritchard 1978). It may be important to improve the potential for migration past dams.

Ewert and Jackson (1994) made recommendations for maintenance of appropriate nesting conditions. Perpetuation of early successional vegetation may be appropriate along some rivers.

As sex in this species is determined by temperature in the nest, the degree of shading of nests may be important to population demography. This may be an additional management concern (D. Jackson, pers. comm., 1992).

Management Research Needs: Research is needed on basic ecology and responses to human-induced habitat modifications: e.g., studies of movement patterns of all demographic categories, use of artificial (e.g., spoil mound) vs. natural nesting substrates, impact of channel dredging and snag removal, effect of harvest, growth rates, hatchling and juvenile ecology, tolerance of pollutants, bioaccumulation of pesticides and heavy metals (e.g., mercury).

Biological Research Needs: Better information is needed on abundance, nesting distribution, and trends.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: None to several (0-12) occurrences appropriately protected and managed

Comments: Parts of inhabited systems are included in many managed areas, including at least 20 in Florida; however, none protects the population of an entire river system..

This species is protected to some degree by all states within its range. Some states prohibit any harvest. Louisiana prohibits commercial harvest but allows recreational harvest of 1 per day per boat or vehicle.

Needs: This species needs better protection from harvest, protection of its riverine habitat (i.e., no degradation, impoundment, dredging, or pollution), and protection of nesting areas (Ewert and Jackson 1994).

Pritchard (1992) recommended that this species be protected from trapping for at least a decade in order to allow populations to recover.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Collecting wild specimens is prohibited in Arkansas, Florida, Georgia, Indiana, Missouri, Tennessee, but allowed with the necessary permit in Alabama, Illinois, Kansas, Louisiana, Oklahoma and Texas. The alligator snapping turtle has been found in reservoirs throughout its range, and dyking of rivers to create winter waterfowl refuges has increased the available habitat in Arkansas and the lower Mississippi Valley, which may help offset some of the habitat degradation and loss seen elsewhere (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Alligator snapping turtles have a dangerous bite, but generally don't attack humans unless provoked.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Alligator snapping turtles play a role in freshwater ecosystems. Adults are not a source of food for any animals other than humans, but eggs and hatchlings are a source of food for large fish, racoons, and birds. Adults are important predators. Humans find them valuable for their unique appearance and their meat.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: This species has been subject to commercial (though often illegal) harvest (Pritchard 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: This large, long-lived aquatic turtle of the southeastern U.S. and Lower Mississippi drainage has declined at least in the northern reaches of its range and in Louisiana where it has been subjected to commercial harvest. However, documentation of population size is so scant that it is not possible to quantify the decline reliably, or to establish the current status range-wide. It is clear that prolonged heavy harvest cannot be withstood. This is evident from the decline in both size and numbers in the Louisiana alligator snapper harvest. Although the turtle is late maturing, it is long-lived, has relatively large clutches and may be able to sustain a minimal level of collection (D. Jackson, pers. comm., 1992). Unfortunately, the data are lacking to quantify the level of sustained harvest that can be tolerated. Elimination of commercial harvest throughout the range would allow alligator snapper populations to recover. Research on the nesting requirements, movements of individuals, population dynamics, and general natural history is needed. Information on range-wide status and population trends is also needed before strong proposals for protection can be justified.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Alligator snapping turtle

The alligator snapping turtle (Macrochelys temminckii) is one of the largest freshwater turtles in the world. It is not closely related to, but is often associated with, the common snapping turtle. They are the sole living member of the genus Macrochelys--while common snappers are in the genus Chelydra. The epithet temminckii is in honor of Dutch zoologist Coenraad Jacob Temminck.[4]

Contents

Distribution and habitat

The largest freshwater turtle in North America, the alligator snapping turtle is found primarily in southern United States waters. They are found from eastern Texas east to the Florida panhandle, and north to southeastern Kansas, Missouri, southeastern Iowa, western Illinois, western Kentucky, and western Tennessee.[5] Typically only nesting females will venture onto open land.[citation needed]

Due to the exotic pet trade and other factors the species has found its way to Asia and Europe with a breeding/research center found in Japan.[6][not in citation given]

Description

Illustration from Holbrook's North American Herpetology, 1842

The alligator snapping turtle is characterized by a large, heavy head, and a long, thick shell with three dorsal ridges of large scales (osteoderms) giving it a primitive appearance reminiscent of some of the plated dinosaurs. They can be immediately distinguished from the Common Snapping Turtle by the three distinct rows of spikes and raised plates on the carapace, whereas the common snapping turtle has a smoother carapace. They are a solid gray, brown, black, or olive-green in color, and often covered with algae. They have radiating yellowpatterns around the eyes, serving to break up the outline of the eye and keep the turtle camouflaged. Their eyes are also surrounded by a star-shaped arrangement of fleshy filamentous "eyelashes."

There is an unverified report of a 403-pound (183 kg) Alligator Snapping Turtle found in Kansas in 1937,[7] but the largest verifiable one is debatable. One weighed at the Shedd Aquarium in Chicago was a 16-year resident giant alligator snapper weighing 249 lb (113 kg), sent to the Tennessee State Aquarium as part of a breeding loan in 1999. Another was 236 lb (107 kg), and housed at the Brookfield Zoo in suburban Chicago. Both of these may still be alive. They generally do not grow quite that large—average adult size is around 26 inches shell length with a weight of 175 lb (80 kg). Males are typically larger than females.[8] Alligator snapping turtles can also range in length from 16 to 32 inches (40.4 to 80.8 cm).[9] Among extant freshwater turtles, only the little-known giant softshell turtles of the genera Rafetus and Pelochelys, native to Asia, reach comparable sizes.

Head of a young alligator snapping turtle
Alligator snapping turtle with carpet of algae

In mature specimens (carapace length over 12 inches) male and female can be differentiated by the position of the cloaca from the carapace and the thickness of the tail's base. A mature male's cloaca extends beyond the carapace edge, a female's is placed exactly on the edge if not nearer to the plastron. The base of the tail of the male is also thicker as compared to females because of the hidden reproductive organs.

The inside of the turtle's mouth is camouflaged, and it possesses a vermiform (literally, "worm-shaped") appendage on the tip of its tongue used to lure fish, a form of Peckhamian mimicry. The turtle hunts by lying motionless in the water with its mouth wide open. The vermiform tongue imitates the movements of a worm, luring prey to the turtle's mouth. The mouth is then closed with tremendous speed and force, completing the ambush.

Contrary to claims that Alligator Snapping Turtles possess the second strongest bite force of any animal, it has been recorded at 158 ± 18 kilograms-force (1,550 ± 180 N; 350 ± 40 lbf) which is lower than several other species of turtle and at about the same level as humans.[10][11] Still, these turtles must be handled with extreme care.[8]

Fossil history

Unlike the family Chelydridae as a whole, the genus Macroclemmys is exclusively North American and is generally considered to contain three valid species: the extant M. temminckii and the extinct M. schmidti and M. auffenbergi (described from the early middle Miocene of Nebraska and the middle Pliocene of Florida, respectively).

Diet

Alligator snappers are opportunistic carnivores more often at a young age, but are also scavengers. Fishermen have glorified the species' ability to catch fish and to deplete fish populations. Minnows are usually the main source of meat for the species at a young age.[citation needed] They will eat almost anything they can catch.

Their natural diet consists primarily of fish and dead fish carcasses (usually thrown overboard by fishermen), invertebrates, carrion, and amphibians, but they are also known to eat snakes, and even other turtles. In captivity they may consume almost any kind of meat provided, including beef, chicken and pork although these are not always healthy on a day to day basis.[citation needed] They will refuse to eat if exposed to temperature extremes. Though not a primary food source for them, adult Alligator snappers have been known to kill and eat small alligators[12] that they have been confined with, such as in a net, small bog, or poorly planned aquarium display.[citation needed]

Reproduction and lifespan

Maturity is reached at around 12 years of age.[13] Mating takes place yearly; early spring in the southern part of their total range, and later spring in the north. The female builds a nest and lays a clutch of 10–50 eggs[9] about 2 months later. The gender of the baby alligator snapping turtles depends on the temperature at which the eggs are incubated. Nests are typically excavated at least 50 yards from the water's edge to prevent them from being flooded and drowned. Incubation takes from 100 to 140 days, and hatchlings emerge in the early fall.[14]

Though their potential lifespans in the wild are unknown, alligator snapping turtles are believed to be capable of living to 200 years of age but 80 to 120 is more likely . In captivity, they typically live from anywhere between 20 to 70 years of age.[15]

In captivity

Correct handling of a 45 pound alligator snapping turtle at Austin Reptile Service, in Austin, Texas.

Alligator snapping turtles are usually captive-bred as pets and are readily available in the exotic animal trade. Due to their potential size and specific needs, they do not make particularly good pets for any but the most experienced aquatic turtle keepers.[16]

They prefer to feed on live fish which they catch with their special technique but would readily feed on other types of meat or leafy vegetables if offered. Hand feeding is dangerous, as an alligator snapping turtle is capable of removing a finger with an errant bite. Temperature extremes are known to affect the turtle's appetite and would result in the turtle refusing to feed until it has been remedied.

Due to its sheer size, handling adult specimens can pose significant problems. The turtle can be handled with relative safety by holding them at the sides of the carapace. A large individual can be held by grasping the turtle firmly in the anterior, just behind the head, and posterior portions of the shell.

Despite their reputation they are typically not prone to biting, but if provoked are quite capable of delivering a bite with their powerful jaws which can cause significant harm to a human, easily amputating fingers.[17] Some states where alligator snapping turtles do not naturally occur (such as California) prohibit them from being kept as pets by residents.

Conservation status

The alligator snapping turtle is primarily vulnerable to humans from habitat loss and hunting. Some are hunted for their carapaces; the plastron of the turtle is valued because of its shape as a cross. There are accounts of large (50+ lb) turtles being caught both purposely and accidentally on recreational fishing lines called "trot lines." Abandoned trot lines are thought to be even more dangerous to turtles. Soup made from snapping turtle meat is considered by some to be a delicacy.

This turtle is protected from collection throughout much of its range. The IUCN lists it as a threatened species, and as of June 14, 2006, it was afforded some international protection by being listed as a CITES 3 species (which will put limits on exportation from the United States and all international trade in this species.).[18] The alligator snapping turtle is now endangered in several states, including Indiana[19] and Illinois. Illinois fishing of snapping turtles is illegal and heavily fined.

References

Citations
  1. ^ a b c Rhodin 2010, p. 000.92
  2. ^ Fritz 2007, p. 172
  3. ^ Fritz 2007, pp. 172-173
  4. ^ "Biographies of People Honored in the Herpetological Nomenclature North America". http://ebeltz.net/herps/biogappx.html. Retrieved 2006-07-09. 
  5. ^ Conant, Roger; Collins, Joseph T. (1991). A Field Guide to Reptiles and Amphibians: Eastern and Central North America (third ed.). Boston: Houghton Mifflin Company. 
  6. ^ "Wanigame mode of life laboratory (Japanese site)". http://wanigame.exblog.jp/. 
  7. ^ "Smithsonian National Zoological Park: Alligator Snapping Turtle". http://nationalzoo.si.edu/Animals/ReptilesAmphibians/Facts/FactSheets/Alligatorsnappingturtle.cfm. Retrieved 2006-03-26. 
  8. ^ a b "Alligator Snapping Turtle: Giant of the Southeastern States". http://www.tortoise.org/archives/macrocl.html. Retrieved 2006-03-26. 
  9. ^ a b Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5. 
  10. ^ Herrell et al. 2002 [1] Evolution of bite performance in turtles. J. Evol. Bio. (15), 1083-1094.
  11. ^ Braun et al. 1995 [2] A study of bite force, part 2: Relationship to various cephalometric measurements. The Angle Orthodontist 65(5), 373-377.
  12. ^ The Bronx Zoo: Alligator Snapping Turtle
  13. ^ "Animal Diversity Web: Macrochelys temminickii". http://animaldiversity.ummz.umich.edu/site/accounts/information/Macrochelys_temminckii.html. Retrieved 2008-09-12. 
  14. ^ "Nashville Zoo: Alligator Snapping Turtle". Archived from the original on 2006-02-21. http://web.archive.org/web/20060221084138/http://www.nashvillezoo.org/asturtle.htm. Retrieved 2006-03-26. 
  15. ^ "WhoZoo: Alligator Snapping Turtle". http://www.whozoo.org/AnlifeSS2001/serishoo/SRS_AlligatorSnappingTurtle.html. Retrieved 2006-03-26. 
  16. ^ AST Care Sheet
  17. ^ "NAS - Species FactSheet". http://nas.er.usgs.gov/queries/FactSheet.asp?speciesID=1227. Retrieved 2006-03-26. 
  18. ^ "Alligator Snapping Turtle and Map Turtles Gain International Protection". http://greennature.com/article2503.html. Retrieved 2006-03-26. 
  19. ^ Indiana Legislative Services Agency (2011), "312 IAC 9-5-4: Endangered species of reptiles and amphibians", Indiana Administrative Code, http://www.in.gov/legislative/iac/, retrieved 28 Apr 2012 
Bibliography
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 1 person

Average rating: 5.0 of 5

Names and Taxonomy

Taxonomy

Comments: This species represents one of only two living genera (each with one living species) in the family. Until recently, this turtle was included in the genus Macroclemys. However, Webb (1995, Chelonian Conservation and Biology 1:322-323) demonstrated that the generic name Macrochelys has priority over Macroclemys. Crother et al. (2000) and Crother (2008) agreed with this conclusion and treated this species as a member of Macrochelys.

MtDNA data indicate three distinctive, regional population assemblages in the southeastern United States: Suwannee River (the most distinctive); all drainages from the Pensacola River in western Florida to the Trinity River in Texas; and all drainages in the Florida panhandle between the Pensacola and Suwannee rivers (Roman et al., 1999; Walker and Avise 1998). In addition, samples from each of several Gulf Coast river drainages display fixed genetic differences, indicating strong contemporary restrictions on interdrainage gene flow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!