Overview

Distribution

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to China, Japan. Introduced in Hawaii (Kauai, Oahu; distribution records should be verified in view of apparent occurrence of a second Trionyx species in Hawaii (see TAXCOM). Introduced and established on Guam, Mariana Islands (McCoid 1993; Campbell and McCoid, 1993, Herpetol. Rev. 24:65).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Asia North-America
Distribution: C/S China (Liaoning, Shaanxi, Anhui, Zhejiang, Guangdong), N Vietnam, Hainan, Taiwan, S Far East (Russia), Korea,  Japan (Bonin Islands), Indonesia (Timor), Japan, Thailand and W Malaysia (introduced), USA (introduced to Hawaii), Brazil  
Type locality: Manzhouli 
Type locality: "kleinen Insel in Tigerfluss, dicht bei Macao" (= small island in the Tiger River near Macao), China (fide KING & BURKE 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 41 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Streams, canals, drainage ditches, ponds, freshwater marshes; eggs are laid in moist soil above water line (McKeown 1978, 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats fishes, crayfishes, molluscs (McKeown 1978), and probably other small aquatic animals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Clutch size 3-28. Eggs hatch in 48-68 days. Up to 4 clutches annually. Sexually mature in 5-6 years (McKeown 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pelodiscus sinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTAACCCGTTGATTATTTTCTACTAACATAAAGACATTGGCACCCTTTATTTTCGGTGCCTGAGCAGGTATAGTTGGTACAGCCTTGAGCTTATTAATCCGAGCAGAACTAAGTCAACCTGGCACTCTTTTAGGGGACGACCAGATTTATAATGTAATTGTTACAGCACATGCTTTTGTTATGATCTTCTTTATAGTCATACCTGTAATAATTGGGGGGTTCGGTAACTGACTTGTACCCTTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTACTACCCCCCTCATTACTACTTCTCCTAGCATCATCAGGCATTGAAACAGGAGCAGGAACTGGCTGAACCGTTTATCCCCCATTAGCTAGCAACCTAGCCCATGTGGGCGCATCAGTAGACTTAACTATTTTCTCCTTACATCTAGCTGGAGTATCTTCAATCCTTGGGGCTATCAATTTTATTACTACAGCTATTAATATAAAATCCCCAACAATATCACAATACCAAACTCCCTTATTCGTTTGATCAGTAGTTATTCAGCCGTACTATTATTACTTTCACTACCAGGGGTTAGCCCGCCAGGCATTTACAATATTACTCACAGACCGAAACCTGAATACTACCTTTTTTGATCCTTCTGGAGGAGGAGATCCTATCCTATATCAACATTTATTCTGATTCTTCGGTCACCCAGAAGTTTACATCCTCATCCTCCCTGGGTTTGGCATAATCTCCCATGTAGTAACGTACTATGCTAATAAAAAAGAACCATTCGGCTATATAGGAATAGTATGAGCAATAATATCAATTGGTTTCCTAGGATTCATTGTATGGGCCCATCATATGTTCACTGTAGGTATAGATGTAGACACACGAGCCTACTTTACATCAGCTACAATAATTATTGCTATCCCGACAGGAGTAAAAGTATTTAGCTGATTAGCCACATTACACGGAGGCCTCATTAAATGAGACGCTGCTATACTATGAGCCCTAGGTTTTATTTTCCTATTTACAATTGGAGGCTTAACAGGTATCGTTTTAGCCAACTCATCATTAGACATTGTATTACACGACACATACTACGTCGTAGCCCATTTCCACTATGTATTATCAATAGGAGCTGTATTTGCTATTATAGCAGGTTTTACCCATTGATTCCCACTTTTCTCTGGTTATTCACTACACCAAACCTGAACCAAAGTACATTTTGGGGTGATATTTGCAGGTGTAAATATAACATTTTTCCCACAACACTTCCTAGGGCTAGCGGGTATACCACGACGCTATTCTGACTACCCAGATGCCTATACCCTATGAAACACCATCTCATCTATCGGATCATTAATCTCCCTAATTGCAGTAATCATAATAATATTCATTATCTGAGAAGCATTCTCATCAAAACGAAAAGTTACAATAATTGAACTCACAACCACCAACGTAGAATGACTTCACGGATGCCCCCCTCCATATCACACCTATGAAGAACCCACCCATGTACAAAACACAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pelodiscus sinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1d+2d

Version
2.3

Year Assessed
2000

Assessor/s
Asian Turtle Trade Working Group

Reviewer/s
Buhlmann, K., Rhodin, A. & van Dijk, P.P. (Tortoise & Freshwater Turtle Red List Authority)

Contributor/s

Justification
The status assessment was made with respect to the natural populations only. The taxonomic and genetic diversity of this taxon (several component species have been described or resurrected in recent years) has been confused and compromised by the mixing of animals of different origin in farms, and the escape of farmed animals into wild populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
While this species is commercially farmed in vast numbers (several millions per year) for the food trade, the wild populations continue to be exploited for food and possibly farm founder stock, resulting in a decline in abundance throughout its wide range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Captured and propagated for food in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chinese softshell turtle

The Chinese softshell turtle, Pelodiscus sinensis, is a species of turtle that was first described by Arend Friedrich August Wiegmann in 1835 (as Trionyx sinensis). The species is also referred to as the Asiatic soft-shelled turtle. There is a subspecies japonicus which is sometimes erroneously listed as Pelodiscus japonica.

Contents

Description

The Chinese softshell turtle can reach a carapace length of 1 ft (0.30 m). It has webbed feet for swimming. They are called "softshell" because their carapace lacks horny scutes (scales). The carapace is leathery and pliable, particularly at the sides. The central part of the carapace has a layer of solid bone beneath it, as in other turtles, but this is absent at the outer edges. The light and flexible shell of these turtles allows them to move more easily in open water, or in muddy lake bottoms.[3]

The carapace of these turtles is olive in color and may have dark blotches. The plastron is orange-red, and may also have large dark blotches. The limbs and head are olive dorsally with the forelimbs lighter and the hind-limbs orange-red ventrally. There are dark flecks on the head and dark lines that radiate from the eyes. The throat is mottled and there may be small, dark bars on the lips. A pair of dark blotches is found in front of the tail as well as a black band on the posterior side of each thigh.[4]

Distribution and habitat

Pelodiscus sinensis distribution map
  Historic distribution
  Modern distribution

Distribution

The Chinese softshell turtle is found in China (including Manchuria), Taiwan, North Vietnam, Japan and Russia.[5][6]

It is difficult to determine its native range due to the long tradition of use as a food and "tonic"[7] and subsequent spread by migrating people.[4] The Chinese soft-shelled turtle has been introduced to Malaysia, Singapore, Thailand, Timor, Batan Islands, Guam, some of the Hawaiian Islands,[8] California[9] and Virginia.[10]

Habitat

Chinese softshell turtles generally live in brackish water.[11] In China these turtles are found in rivers, lakes, ponds, canals and creeks with slow currents, and in Hawaii they can be found in marshes and drainage ditches.[4]

Ecology and behavior

Diet

These turtles are predominantly carnivorous and the remains of fish, crustaceans, mollusks, insects, and seeds of marsh plants have been found in their stomachs.[4] They forage at night.

Movement

With their long snout and tubelike nostrils, these turtles can "snorkel" in shallow water.[12] When resting, they lie at the bottom, buried in sand or mud, lifting their head to breathe or snatch at prey. Their basking habit is not well developed.[4]

Chinese softshell turtles often submerge their heads in water.[12] This is because they carry a gene which produces a protein that allows them to secrete urea from their mouths. This adaptation helps them survive in brackish water by making it possible for them to excrete urea without drinking too much salty water. Rather than eliminating urea by urinating through their cloaca as most turtles do, which involves significant water loss, they simply rinse their mouths in the water.[11][13]

When provoked, certain populations of these turtles are capable of excreting a foul smelling fluid from pores on the anterior edge of their shells.[14]

Life cycle

These turtles reach sexual maturity sometime between 4 and 6 years of age. They mate at the surface or under water. A male will hold the female's carapace with its forelimbs and may bite at her head, neck, and limbs. Females may retain sperm for almost a year after copulation.[4]

The females lay 8–30 eggs in a clutch and may lay from 2 to 5 clutches each year. The eggs are laid in a nest that is about 3–4 in (76–100 mm) across at the entrance. Eggs are spherical and average about 20 mm (0.79 in) in diameter. After an incubation period of about 60 days, which may be longer or shorter depending upon temperature, the eggs hatch. Average hatchling carapace length is about 1 in (25 mm) and width is also about 1 in (25 mm).[4] Sex of the hatchlings is not determined by incubation temperature.[14]

Conservation

Wild populations are listed as vulnerable on the IUCN Red List.[2]

Relations with humans

The Chinese softshell turtle is the turtle species raised on China's turtle farms. According to the data obtained from 684 Chinese turtle farms, they sold over 91 million turtles of this species every year; considering that these farms represented less than half of the 1,499 registered turtle farms in China, the nationwide total could be over twice as high.[15] These turtles are considered a delicacy in many parts of Asia.[12] Turtle soup is made from this species. In Japan, they may be stewed with hōtō noodles and served as a winter delicacy. Many Koreans, even today, generally have a taboo against eating turtles which has origins in native Korean Shamanism.

These turtles can be injured if they are dropped or hit, and are susceptible to shell fungus. Within Europe, the turtle is a popular pet, particularly in countries such as Italy and the Czech Republic. Captives of this species will eat canned and fresh fish, canned dog food, raw beef, mice, frogs, and chicken.[4]

Synonyms

  • Testudo rostrata Thunberg, 1787 (nomen suppressum)
  • Testudo striata Suckow, 1798
  • Testudo semimembranacea Hermann, 1804 (nomen suppressum et rejectum)
  • Emydes rostrataBrongniart, 1805
  • Trionyx (Aspidonectes) sinensis Wiegmann, 1834 (nomen conservandum)
  • Trionyx japonicusTemminck & Schlegel, 1835
  • Trionyx tuberculatus Cantor, 1842
  • Pelodiscus sinensisFitzinger, 1843
  • Tyrse perocellata Gray, 1844
  • Trionyx perocellatusGray, 1856
  • Trionyx schlegelii Brandt, 1857
  • Potamochelys perocellatusGray, 1864
  • Potamochelys tuberculatusGray, 1864
  • Landemania irrorata Gray, 1869
  • Landemania perocellataGray, 1869
  • Trionyx peroculatus Günther, 1869 (ex errore)
  • Gymnopus perocellatusDavid, 1872
  • Gymnopus simonii David, 1875 (nomen nudum)
  • Ceramopelta latirostris Heude, 1880
  • Cinctisternum bicinctum Heude, 1880
  • Coelognathus novemcostatus Heude, 1880
  • Coptopelta septemcostata Heude, 1880
  • Gomphopelta officinae Heude, 1880
  • Psilognathus laevis Heude, 1880
  • Temnognathus mordax Heude, 1880
  • Trionyx sinensis newtoni Bethencourt-Ferreira, 1897
  • Tortisternum novemcostatum Heude, 1880
  • Temnognanthus mordaxBoulenger, 1889
  • Tyrse sinensisHay, 1904
  • Amyda japonicaStejneger, 1907
  • Amyda schlegeliiStejneger, 1907
  • Amyda sinensisStejneger, 1907
  • Amyda tuberculataSchmidt, 1927
  • Trionyx sinensis sinensisSmith, 1931
  • Trionyx sinensis tuberculatusSmith, 1931
  • Amyda schlegelii haseri Pavlov, 1932
  • Amyda schlegelii licenti Pavlov, 1932
  • Amyda sinensis sinensisMertens, Müller & Rust, 1934
  • Amyda sinensis tuberculataMertens, Müller & Rust, 1934
  • Trionyx schlegeli Chkhikvadze, 1987 (ex errore)
  • Trionix sinensisRichard, 1999
  • Pelodiscus sinensis sinensisFerri, 2002
  • Pelodiscus sinensis tuberculatusFerri, 2002
  • Pelodiscus sinensis japonicusJoseph-Ouni, 2004

[16]

References

  1. ^ a b Rhodin 2010, p. 000.128
  2. ^ a b Asian Turtle Trade Working Group (2000). "Pelodiscus sinensis". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 22 October 2012. 
  3. ^ Obst, Fritz Jurgen (1998). In Cogger, H. G. & Zweifel, R. G. Encyclopedia of Reptiles and Amphibians. San Diego: Academic Press. pp. 117–118. ISBN 0-12-178560-2. 
  4. ^ a b c d e f g h C.H. Ernst, R.G.M. Altenburg & R.W. Barbour - Turtles of the World - Pelodiscus sinensis [1]
  5. ^ Distribution map from WWF: shows the species' distribution within NE China and Russian Far East
  6. ^ "Khankaisky Zapovednik". The Center for Russian Nature Conservation (CRNC). 
  7. ^ Louis A. Somma. 2009. Pelodiscus sinensis. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. [2] Revision Date: 6/29/2004 Accessed: 15/05/2009
  8. ^ Brock, V. E. (1947). "The establishment of Trionyx sinensis in Hawaii". Copeia 1947 (2): 142. 
  9. ^ Van Denburgh, John (1897). "The Reptiles of the Pacific Coast and Great Basin: An account of the species known to inhabit California, Oregon, Washington, Idaho and Nevada". Occasional Papers of the California Academy of Sciences 5: 28. 
  10. ^ Mitchell, J. C., B. W. Steury, K. A. Buhlmann, & P. P. van Dijk (2007). "Chinese softshell turtle (Pelodiscus sinensis) in the Potomac River and notes on eastern spiny softshells (Apalone spinifera) in Northern Virginia". Banisteria 30: 41–43. 
  11. ^ a b Kaufman, Rachel (12). "Turtles Urinate Via Their Mouths—A First". National Geographic. Retrieved 14 October 2012. 
  12. ^ a b c Davies, Ella. "Chinese turtle passes waste urea through its mouth". BBC Nature. Retrieved 19 October 2012. 
  13. ^ Give us a kiss! The turtle that urinates through its mouth... and is a delicacy in Chinese restaurants | Mail Online
  14. ^ a b Bonin, Frank (2006). Turtles of the World. Baltimore, Maryland: The Johns Hopkins Press. pp. 146–147. 
  15. ^ Shi, Haitao; Parham, James F; Fan, Zhiyong; Hong, Meiling; Yin, Feng (2008-01-01), "Evidence for the massive scale of turtle farming in China", Oryx (Cambridge University Press) 42: 147–150, doi:10.1017/S0030605308000562, retrieved 2009-12-26 
  16. ^ Fritz Uwe; Peter Havaš (2007). "Checklist of Chelonians of the World". Vertebrate Zoology 57 (2): 319–320. ISSN 18640-5755. Archived from the original on 2010-12-17. Retrieved 29 May 2012. 

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Removed from genus Trionyx and placed in genus Pelodiscus by Meylan (1987). Retained in genus Trionyx by Webb (1990). Specimens from Hawaii have been confused with Palea (Trionyx) STEINDACHNERI, which apparently also occurs there (see Webb 1980, McKeown 1978). An earlier specific name, ROSTRATA Thunberg, 1787, has been suppressed by the ICZN (see 1991 Bull. Zool. Nomen. 48(3):276).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!