Overview

Distribution

Continent: Africa
Distribution: Ethiopia, Eritrea, Somalia, Sudan, Chad ?, Central African Republic, Cameroon ?,  Benin ?, Togo ?, Ghana, Senegal, Mali , Nigeria, Cameroon, Niger, Congo, Mauritania,  Republic of South Africa, Madagascar, Swaziland, Botswana, Tanzania; elevations up to 3000 m in East Africa fide WERNING & WOLF 2007), Kenya  nigra: South Africa  olivacea: Ethiopia, Sudan, W to Cameroon and Nigeria, Gambia  
Type locality: "Indes" (in error); designated by Mertens (1937:141), as Cape of Good Hope, Republic of South Africa; designated by Bour (1982) as "Tadanaro (Fort Dauphin), Republique Malagasy" (=Madagascar).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 20.1 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pelomedusa subrufa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGCTGACTATTCTCTACTAACCATAAAGACATTGGTACCCTTTATCTAATCTTCGGGGCCTGAGCAGGAATAATTGGTACCGCCCTTAGTCTCCTAATTCGAACTGAACTTAATCAGCCAGGAAACCTCCTCGGTAGC---GATCAAACCTATAACGTCATTGTCACAGCCCATGCATTCGTCATAATCTTCTTTATAGTTATACCTGTTATAATTGGAGGATTCGGAAATTGATTAGTACCTCTAATAATCGGAGCCCCAGATATAGCATTTCCGCGTCTAAATAATATAAGCTTCTGACTTTTACCTCCATCCCTCCTTCTTATACTTGCTTCATCTGCAATTGAAGCCGGAGCAGGAACAGGTTGAACAGTTTATCCCCCATTAGCAAGTAACCTAGCCCACGCCGGTGCATCCGTAGACCTAGCTATCTTTTCCCTACATTTAGCAGGGGCATCCTCCATCTTAGGGGCCATCAACTTTATCACTACAGTGATTAATATAAAAACCCCAAACATATCTTTTCTAGACATACCATTATTTGTCTGATCCGTACTAATCACAGCCATCTTACTACTATTATCCCTTCCAGTGCTCGCAGCAGGAATTACCATACTTTTAACAGATCGAAACTTAAACACAACCTTCTTCGACCCATCAGGAGGAGGGGACCCAATCCTATATCAACACCTGTTCTGATTCTTTGGTCATCCAGAAGTATATATTCTCATCCTACCAGGATTTGGCATCATTTCACATATTGTCGCCTACTACTCAACAAAAAAAGAACCATTCGGTTACATTGGAATAGTTTGAGCAATAACATCAATTGGATTCCTAGGTTTTATTGTTTGAGCACACCATATATTCACTGTGGGAATAAATGTAAATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pelomedusa subrufa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!