Overview

Distribution

Continent: Africa
Distribution: Ethiopia, Eritrea, Somalia, Sudan, Chad ?, Central African Republic, Cameroon ?,  Benin ?, Togo ?, Ghana, Senegal, Mali , Nigeria, Cameroon, Niger, Congo, Mauritania,  Republic of South Africa, Madagascar, Swaziland, Botswana, Tanzania; elevations up to 3000 m in East Africa fide WERNING & WOLF 2007), Kenya  nigra: South Africa  olivacea: Ethiopia, Sudan, W to Cameroon and Nigeria, Gambia  
Type locality: "Indes" (in error); designated by Mertens (1937:141), as Cape of Good Hope, Republic of South Africa; designated by Bour (1982) as "Tadanaro (Fort Dauphin), Republique Malagasy" (=Madagascar).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 20.1 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pelomedusa subrufa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGCTGACTATTCTCTACTAACCATAAAGACATTGGTACCCTTTATCTAATCTTCGGGGCCTGAGCAGGAATAATTGGTACCGCCCTTAGTCTCCTAATTCGAACTGAACTTAATCAGCCAGGAAACCTCCTCGGTAGC---GATCAAACCTATAACGTCATTGTCACAGCCCATGCATTCGTCATAATCTTCTTTATAGTTATACCTGTTATAATTGGAGGATTCGGAAATTGATTAGTACCTCTAATAATCGGAGCCCCAGATATAGCATTTCCGCGTCTAAATAATATAAGCTTCTGACTTTTACCTCCATCCCTCCTTCTTATACTTGCTTCATCTGCAATTGAAGCCGGAGCAGGAACAGGTTGAACAGTTTATCCCCCATTAGCAAGTAACCTAGCCCACGCCGGTGCATCCGTAGACCTAGCTATCTTTTCCCTACATTTAGCAGGGGCATCCTCCATCTTAGGGGCCATCAACTTTATCACTACAGTGATTAATATAAAAACCCCAAACATATCTTTTCTAGACATACCATTATTTGTCTGATCCGTACTAATCACAGCCATCTTACTACTATTATCCCTTCCAGTGCTCGCAGCAGGAATTACCATACTTTTAACAGATCGAAACTTAAACACAACCTTCTTCGACCCATCAGGAGGAGGGGACCCAATCCTATATCAACACCTGTTCTGATTCTTTGGTCATCCAGAAGTATATATTCTCATCCTACCAGGATTTGGCATCATTTCACATATTGTCGCCTACTACTCAACAAAAAAAGAACCATTCGGTTACATTGGAATAGTTTGAGCAATAACATCAATTGGATTCCTAGGTTTTATTGTTTGAGCACACCATATATTCACTGTGGGAATAAATGTAAATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pelomedusa subrufa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

African helmeted turtle

The African helmeted turtle (Pelomedusa subrufa) also known as the marsh terrapin or crocodile turtle, is an omnivorous side-necked terrapin that naturally occurs in fresh and stagnant water bodies throughout much of Africa, and even in southern Yemen.

Description[edit]

Side view of a captive specimen, showing claws and lighter underside

The Marsh Terrapin is typically a rather small turtle, with most individuals being less than 20 cm in carapace length, but one has been recorded with a carapace length of 32.5 cm. It has a black or brown carapace (shell). The tops of the tail and limbs are a grayish brown, while the underside is yellowish.

The male turtle is distinguished by its long, thick tail. A female tends to have a shorter tail and a broader carapace. A hatchling has a shell size of about 1.2 inches in length, and is olive to black in color. It also has two small tubercles under the chin and musk glands in the sides of the carapace.

Uniquely, this species does not have a hinged plastron (lower shell). All the other species in the family Pelomedusidae, however, have this feature which they can, using muscles, close to cover their heads and front limbs. Unlike many chelonians, African helmeted turtles are able, when they find themselves upside down, to right themselves with a vigorous flick from their long muscular necks.[2]

Distribution[edit]

The range of P. subrufa covers a large portion of Africa, from the Cape Peninsula to the Sudan. It can be found as far west as Ghana and as far south as Cape Town. It has also been found in Madagascar and Yemen.[3]

Life history[edit]

Adult specimen running down a lake embankment.
Pelomedusa subrufa - African Marsh Terrapin - Garden Pond 2.JPG
A juvenile marsh terrapin

Habitat[edit]

They are semiaquatic animals, living in rivers, lakes, and marshes, and they also occupy rain pools and places that are fertilized.

Their preference seems to be for standing water, such as swamps, pans, dams and lakes. However they are found to a lesser extent along rivers. They are generally absent from regions that are mountainous, forested or desert.[4]

Diet[edit]

The African helmeted turtle is omnivorous and will eat almost anything. Some of the main items in its diet are insects, small crustaceans, fish, tadpoles, earthworms, snails and vegetation. It may also feed on carrion. The fine claws on its feet help it tear its prey apart.

Groups of these turtles have been observed capturing and drowning larger prey such as doves when they come to drink; the commotion caused by these group attacks are often mistaken for crocodiles. All food is taken underwater to be eaten.[5]

Seasonal movements[edit]

During wet weather these terrapins will often leave their water bodies and embark on long overland journeys. During exceptionally dry weather when their water bodies dry up, they will typically dig themselves into the ground and bury themselves until rains return; they have been known to spend months or even years in such a state. They will also hibernate during very cold weather, and aestivate during unusually hot, dry weather.

Reproduction[edit]

Courtship is held year round. The male will follow the female, nodding his head in front of hers. If she is not responsive, she will nip and snap and walk away. If she is willing, she responses by nodding her head or just standing still, so he can sit onto her. While mating both of the turtles shake their head.

The female will lay two to 10 eggs on average, normally during late spring and early summer. The eggs are placed in a flask-shaped nest about 4 to 7 in deep. The eggs hatch in 75– 90 days.[6]

References[edit]

  1. ^ Fritz Uwe; Peter Havaš (2007). "Checklist of Chelonians of the World". Vertebrate Zoology 57 (2): 344–346. Archived from the original on 2010-12-17. Retrieved 29 May 2012. 
  2. ^ E.H.W. Baard: Cape Tortoises: Their identification and care. Cape Nature Conservation. 1994.
  3. ^ B.Branch: Tortoises, Terrapins and Turtles of Africa. Struik Publishers. 2001. ISBN 978-1770074637
  4. ^ R. Boycott, O. Bourquin: The South African Tortoise Book. Southern Book Publishers: Johannesburg. 1988. p.60.
  5. ^ "Crocodile turtle or African helmeted turtle". Snakes-n-Scales. Retrieved 4 May 2014. 
  6. ^ R. Orenstein: Turtles, Tortoises and Terrapins: A Natural History. ISBN 1770851194
  • Richard C. Boycott and Ortwin Bourquin: The southern African Toirtoise Book – A Guide to southern African Tortoises, Terrapins and Turtles, O. Bourqin, KiwaZulu-Natal 2000, ISBN 0-620-26536-1
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!