Overview

Distribution

Geographic Range

Pogona vitticeps has a wide natural distribution in eastern and central Australia. They are found from the eastern half of south Australia to the southeastern Northern Territory (Grenard 1999).

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Australia
Distribution: Australia (New South Wales, North Territory, Queensland, South Australia, Victoria)  
Type locality: Australia
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Inland Bearded Dragons are 13 to 24 inches long, including the tail. They are appropriately named bearded dragons because of their "beard," an expandable throat pouch with spikey scales. They have a broad, triangular head, round bodies, stout legs, and robust tails. Color for this species depends on the soil of the region they live in, ranging from dull brown to tan with red or gold highlights (Tosney 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Pogona vitticeps occupies a large range of habitats from the desert to dry forests and scrublands. It is a semiarboreal lizard that can be found basking on fallen branches, fence posts and picnic tables (Grenard 1999).

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Pogona vitticeps are opportunistic omnivores. They live in areas where food may be hard to find, so bearded dragons are not finicky eaters. Their stomachs are large to accommodate large quantities of plant matter, insects, and the occasional small rodent or lizard (Grenard 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Inland Bearded dragons reach sexual maturity at 1 to 2 years of age. Mating occurs in the Australian spring and summer months of September to March. However, captive indoor dragons do not seem to be seasonal and can breed year round (Grenard 1999). Females dig a burrow and lay up to 24 eggs per clutch, and up to 9 clutches per year. Females have also been known to store sperm and are able to lay many clutches of fertile eggs from one mating (Tosney 1996). In captive conditions, the eggs will hatch in 55 to 75 days, at 28.9 degrees Celsius (Vosjoli 1993).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pogona vitticeps

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0070-06|AB166795|Pogona vitticeps| AACCGATGACTACTATCCACAAACCACAAAGATATCGGAACCCTGTATTTCCTATTTGGTGTTGGCCCTGGAATACCAGGA---TCCGTTACCAGCCTACTAATTCGAATAAAACTAATCCAACCAGGGGAATCCTCAGGAGGG---GACTCACTATATAACATATTCATCACATACCATGCACTAACTATAATCTTCTTCATAGTTATACCAATCATGATCGGGGGATTCGGAAACTGACTCGTACCATTAATA---CTAGGTGCCCCCGACATAGCCTTTCCACGCCTAAACAACATAAGCTTCTGACTTCTCCCCCCATCTTTCCTCCTCCTTATATCCACTGCTTGATTCAACTCAGGAGTAGGAACAGGATGAACCATCTACCCGCCCCTCTCAGGAAACCTAGCCCACGCCGGCCCATCAATAGACCTT---GCCATCTTCGCCCTACACTTAGCAGGAGCATCCTCCATCCTTGGCGCAATTAATTTCATTACCACCTGCATCAACATATCTCCCCACCACATATCTCCGTACAACTGACCCCTATTCGTCTGATCAGTTTTCCTCACAGCCATTCTTCTACTACTATCACTCCCAGTACTAGCCGCA---GCCATCACCATACTACTAACAGACCGAAACCTAAACACCACCTTCTTTGACCCAAATGGAGGAGGAGACCCAATCCTATTCCAACACTTATTCTGATTCTTTGGCCACCCGGAAGTCTACATTCTTATCCTACCCGGATTTGGAATAATCTCACACATTGTTACCCATCACTCCAGCAAAAAA---GAACCCTTCGGCTATATAAGCATAGTTTGAGCCATACTAGCAATTACCGTCCTAGGATTTATTGTTTGAGCACATCACATGTTCACAGTAGGACTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pogona vitticeps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Inland bearded dragons have been used in scientific research (Wood 1995). They are also very popular in the pet trade. In recent years, the bearded dragon has become a favorite reptile to keep and breed because of their manageable size and pleasant temperament. With their array of social behaviors and inquisitive nature, bearded dragons quickly become endearing to their keepers (Tosney 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Central Bearded Dragon

Pogona vitticeps, the central (or inland) bearded dragon, is a species of agamid lizard occurring in a wide range of arid to semiarid regions of Australia. This species is very popularly kept as a pet and exhibited in zoos.

Contents

Description

Detail of the "beard"

Adults of this species usually grow to be about two feet in length, with the tail accounting for over half of the total body length. Sexes are not strongly dimorphic, but males can be distinguished from females, as males have a wider cloacal opening, the base of the tail is wider, the head is usually larger with a larger beard (often black) and possess hemipenes.[1] Males also have more pronounced femoral pores than females (these can be seen as waxy bumps on the underside of the back legs). [2] Bearded dragons vary widely in colour, including brown, grey, reddish-brown, red, yellow, white, orange, and sometimes green. They are capable of undergoing moderate changes in the shade of their colour to help regulate temperature. The specialized scales along both sides of the throat, neck, and head form many narrow spines which run down the side of the body to the tail. When feeling threatened, a bearded dragon will flatten its body against the ground, puff out its spiny throat, and open its jaws to make itself appear larger. The bearded dragon is so named because of the pouch-like projection (also called the guttural pouch) on the underside of the neck and chin area which typically turns darker than the rest of the body. It also boasts spiny projections. Both of these characteristics appear similar to a human's beard. Males typically have a darker "beard" than females, and during mating season and courtship it will typically darken to near-black. The bearded dragon, like most agamid lizards, has strong legs which enable it to lift its body completely off the ground while it moves. This is done to reduce the heat taken in from the ground, as well as to increase the air flow over the belly to cool itself further.

Pogona vitticeps was first described by Ernst Ahl in 1926, who placed it in the genus Amphibolurus.[3] [4]

Ecology and behavior

Zoo Dvůr Králové Czech Republic
Taken at the Cincinnati Zoo

This dragon is native to the semiarid woodland, arid woodland, and rocky desert regions of Central Australia. They are skilled climbers, and often spend just as much time perching on tree limbs, fenceposts, and in bushes as they do on the ground. They spend the morning and early evening sunning themselves on exposed branches or rocks, and retreat to shady areas or underground burrows during the hottest parts of the afternoon.

Bearded dragons do not vocalize, except to hiss softly when threatened. Instead, they communicate through color displays, posture, and physical gestures, such as leg waving and head bobbing. Bearded dragons are not social animals, but will sometimes gather in groups, especially in popular feeding or basking areas. At these times, a distinct hierarchy will emerge: the highest-ranking animals will take the best - usually the highest or sunniest - basking spots, and all other individuals arrange themselves lower down. If a low-ranking animal tries to challenge one of the dominant dragons, the dominant animal will demonstrate its superiority by bobbing its head and inflating its beard, at which point the challenger may signal submission by waving one of its forelegs in a slow circle. If the low-ranking dragon does not submit, it will return the head bob, and a stand off or fight may ensue.

The several different kinds of head bob gestures are:

  • Slow bowing motion - often used by adult females to signal submission to a male
  • Fast bob - used by males to signal dominance (often accompanied by an inflated and/or blackened beard)
  • Violent bob - used by males just before mating, much more vigorous, and usually sets the animal's whole body in motion

The male will only wave to show submission to a dominant male, whereas the female will wave, followed by a slow head bob, to show she is ready to mate. Gravid females will often refuse the advances of a male by chasing him and lying on his back.

When under direct attack, the central bearded dragon opens its mouth to display its yellow membranes and extend its beard.[5] It darkens the colour of its skin and flattens its body, and will hiss and make small jumps towards the attacker.[6]

Reproduction

Baby bearded dragon

The age of sexual maturity has not been measured, although it is estimated to be about two or three years.[7] Body size and growth rates are more important than age when determining sexual maturity in bearded dragons.[8] Males will become very aggressive towards each other and will assert their dominance by inflating their beards and through fast head bobbing. Breeding typically occurs in the early spring. Females will lay a clutch of 11-30 oblong-shaped eggs in a shallow nest dug in the sand. After being laid, the eggs are buried and are left unattended. The eggs will hatch approximately 60 to 80 days later, depending on the incubation temperature. In captivity, they can be incubated in a styrofoam fish box, but without a male lizard, the female's eggs will not be fertile. However, a female bearded dragon can retain sperm, and thus produce fertile eggs even after being separated from a male.

Courtship involves the male "head bobbing" to display dominance. If the female displays submissive behavior, the male will use its mouth to grab the back of the female's head and the male will also wrap its front legs around the female's upper torso to keep her from moving. Copulation and insemination are quick. The gestation period averages about a month and a half.

Captive breeding

Exhibit at the Henry Doorly Zoo

Several of the Pogona genus are bred in captivity as pets; the two most popular are this species, P. vitticeps, and the western bearded dragon (Pogona minor minor).[9][10] The bulk of captive-bred bearded dragons today are thought to have originated from stock illegally exported from Australia during the 1970s. [11]

Captives world wide are threatened by Agamid adenovirus, a virus that compromises the immune system of the dragon, and leads to death from other diseases; however, majority of the infections are subclinical. Subclinically infected animals show no symptoms, but are active carriers of the disease and will infect other bearded dragons.

When the female is ready to lay eggs, she will generally stop eating and spend most of her time trying to dig.[citation needed]

See also

References

  1. ^ Doneley, B. (2006). Caring for the bearded dragon. Proceedings of the North American Veterinary Conference (20): 1607-1611.
  2. ^ http://www.reptilespecialists.com/caresheets/beardeddragon.html
  3. ^ Ahl,E. 1926. Neue Eidechsen und Amphibien. Zool. Anz. 67: 186-192
  4. ^ Pogona vitticeps at the Reptarium.cz Reptile Database
  5. ^ Witten, G.J. (1993). No. 29 Family Agamidae. Fauna of Australia. Volume 2A. AGPS Canberra
  6. ^ Doneley, B. (2006). Caring for the bearded dragon. Proceedings of the North American Veterinary Conference (20): 1607-1611.
  7. ^ DPIPWE (2011) Pest Risk Assessment: Central bearded dragon (Pogona vitticeps). Department of Primary Industries, Parks, Water and Environment. Hobart, Tasmania.
  8. ^ Doneley, B. (2006). Caring for the bearded dragon. Proceedings of the North American Veterinary Conference (20): 1607-1611.
  9. ^ "Pet Profile - Bearded Dragons". The Pet Show. Australian Broadcasting Corporation. 2008. http://www.abc.net.au/tv/petshow/txt/s1653176.htm. "also known as the Lizard of Oz, is a popular type of pet reptile, both here and around the world." 
  10. ^ Browne-Cooper, Robert; Brian Bush, Brad Maryan, David Robinson (2007). Reptiles and Frogs in the Bush: Southwestern Australia. University of Western Australia Press. pp. 161. ISBN [[Special:BookSources/97781920694746|97781920694746]]. "Western Bearded Dragon, Pogona minor minor" 
  11. ^ Steve Grenard - Your Happy Healthy Pet: Bearded Dragon 2nd Edition, page 35
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!