Overview

Distribution

Range Description

This species occurs in the western United States and northwestern Mexico. Its range extends from Washington and southwestern Idaho south through Oregon, California, Nevada, and western Utah to northwestern Baja California (Bell and Price 1996, Grismer 2002, Stebbins 2003), and disjunctly south to Isla de Cedros of the Pacific coast of Baja California (Grismer and Mellink, 1994). Its elevational range extends from sea level to about 3,353 m (11,000 feet) (Bell and Price 1996, Stebbins 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) The range extends from Washington and southeastern Idaho south through Oregon, California, Nevada, and western Utah to northwestern Baja California (Bell and Price 1996, Grismer 2002, Stebbins 2003), and disjunctly south to Isla de Cedros (Grismer and Mellink, 1994, J. Herpetol. 28:120-126). Elevational range extends from sea level to about 11,000 feet (3,353 meters) (Bell and Price 1996, Stebbins 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Middle-America North-America
Distribution: USA (Washington, Oregon, California, Nevada, W Utah),  Mexico (N Baja California Norte, Isla de Cedros)  becki:
Type locality: San Miguel Island, Gulf of California, Mexico.  biseriatus: S Idaho, southwest through Nevada and W Utah into California and the San Pedro Mártir Range in Baja California.
Type locality: Borders of El Paso Creek and Tejon Valley. Restricted to El Paso Creek by SMITH & TAYLOR 1950. (El Paso Creek is in Kern Co., about ten miles  northeast of Ft. Tejon).  bocourti: USA (California).
Type locality: Restricted by Bell (1954), through lectotype designation, to Santa Cruz, Santa  Cruz Co., California.  longipes:
Type locality: Fort Tejon, California [Kern County].  taylori:
Type locality: Half-way between Merced Lake and Sunrise Trail (Echo Creek Basin), elevation 7500 feet, Yosemite National Park, California.   
Type locality: “California and probably Oregon”; restricted to “Benicia, Solano County, California” by GRINNEL & CAMP 1917
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 24 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Sceloporus occidentalis
Catalog Number: USNM 8612
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1872
Locality: Beaver, Utah, United States, North America
  • Syntype: Cope, E. D. 1872. Report upon Geographical and Geological Explorations and Surveys West of the Hundredth Meridian in Charge of First Lieutenant George M. Wheeler, Zoology. 573, plate 24, figures 2-2a.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This lizard occupies various habitats, including grassland, sagebrush, woodland, open coniferous forest, rocky canyons, talus slopes, fence rows, etc. (Stebbins 2003). This species is not found in severe desert areas, but it comes close on mountain slopes (Stebbins 2003). Usually it is on the ground or on low perches (e.g., logs, fences), but sometimes climbs well up into taller bushes or trees. Eggs are buried in loose soil. It is largely tolerant of human disturbed areas. On Isla de Cedros, it is found in pine forest in the upper elevations of the island.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: This lizard occupies various habitats, including grassland, sagebrush, woodland, open coniferous forest, rocky canyons, talus slopes, fence rows, etc. (Stebbins 2003). This species is not found in severe desert areas, but it comes close on mountain slopes (Stebbins 2003). Usually it is on the ground or on low perches (e.g., logs, fences), but sometimes climbs well up into taller bushes or trees. Eggs are buried in loose soil.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly insects (e.g. beetles, flies, caterpillars, and ants) and spiders.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by hundreds of collection sites (e.g., see Nussbaum et al. 1983, Bell and Price 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but certainly exceeds 100,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Adult males defend home range during breeding season. Seasonal home range generally much less than 0.01 ha in central California (Davis and Ford 1983). Predators: predatory birds and snakes.

When individuals on tree trunks are approached closely, they often move to the other side of the trunk.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: These lizards are generally inactive during cold weather. Duration of the inactive period varies with local climate. Emergence from hibernacula occurs in late winter or early spring, depending on local conditions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Courtship and mating generally occur in spring. Egg laying extends from April or May to June or July in most areas. Eggs are buried in loose soil or secluded in old logs or under rocks. Clutch size in different areas ranges from 3 to 17; clutch size tends to increase with female size, latitude, and elevation. Eggs hatch in about 2 months, mostly in August or September in many areas. Individuals first breed in the spring of their second year (Nussbaum et al. 1983, Stebbins 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sceloporus occidentalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGTCCATTAACCGTTGATTTTTCTCAACAAACCATAAAGATATCGGCACCCTATATCTAGTCTTTGGTGCTTGAGCTGGGATAGTCGGAACCGCCCTTAGTCTCCTGATCCGAGCAGAGCTCAGTCAACCCGGGGCCCTGCTAGGAGACGACCAAATTTACAACGTTATTGTAACCGCCCATGCATTTGTCATAATCTTCTTTATGGTTATACCAATCATAATCGGGGGGTTCGGAAACTGACTAGTCCCATTAATAATCGGCGCTCCAGACATGGCCTTCCCACGTATAAACAACATGAGCTTCTGACTCCTCCCACCATCATTCCTCCTTCTCCTGGCCTCATCTGGAGTAGAGGCCGGAGCAGGCACAGGATGAACCGTATACCCACCCCTTGCTAGCAACCTAGCCCACGCAGGAGCCTCCGTAGACCTTACAATTTTCTCCCTTCACCTTGCAGGTGTTTCATCCATTCTTGGAGCAATTAATTTTATTACAACATGCATTAACATAAAGCCCCCCACAATGACACAATACCAAACCCCACTATTTGTGTGATCCGTATTAATCACAGCAGTACTACTTCTCCTATCGCTCCCAGTCTTAGCCGCCGGAATTACAATACTATTAACAGACCGAAACTTAAACACATCATTCTTTGACCCGGCAGGCGGAGGAGACCCGGTGCTATACCAACACCTATTCTGGTTCTTCGGACACCCAGAGGTCTACATTCTGATCCTGCCTGGGTTTGGGATAATCTCTCACATTGTAACCTACTACGCGGGGAAAAAGGAACCCTTCGGCTACATGGGGATAGTTTGGGCAATAATGTCAATTGGTTTCCTTGGGTTTATTGTCTGAGCACACCACATATTCACAGTAGGGATAGACGTAGACACTCGAGCATACTTTACATCAGCCACAATAATTATTGCAATCCCAACTGGAGTCAAAGTTTTTAGCTGACTAGCAACCCTACACGGAGGCACAATTAAATGGGACGCAGCCATACTATGAGCGCTCGGCTTTATTTTCCTATTTACAGTGGGCGGACTGACCGGGATTGTCCTAGCCAATTCATCCCTTGACATCGTACTACATGACACTTACTACGTAGTAGCCCACTTCCACTACGTCTTATCCATGGGCGCTGTTTTCGCCATCATGGGCGGATTCGTCCACTGATTCCCACTATTTTCGGGCTTCGCCCTCCACAACACATGAACAAAAATCCAATTTGGAGTAATGTTCTTAGGCGTAAACATAACATTTTTCCCACAACACTTCCTCGGACTCGCCGGCATGCCCCGACGATATTCAGACTACCCAGACGCCTACACCCTTTGAAACACCGTCTCATCAGTCGGATCCCTAATCTCACTAGTAGCTGTAATTATAATGATGTTTATTATTTGAGAAGCTTTCGCAGCCAAACGTGAAATCTCTTCACTAGAACTAACAACTACTAACATTGAATGACTCCACGGCTGCCCGCCCCCTTATCACACATACGAAGAGCCCGCCTACGTACAAACAACTTCGAGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sceloporus occidentalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Hollingsworth, B. & Hammerson, G.A.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is a common species is represented by hundreds of collection sites (e.g., see Nussbaum et al. 1983, Bell and Price 1996). The total adult population size is unknown but certainly exceeds 100,000, and probably numbers many millions. Its extent of occurrence, area of occupancy, and population size are large and probably relatively stable (or slowly declining).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Extent of occurrence, area of occupancy, and population size are large and probably relatively stable (or slowly declining).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats have been identified. Locally, conversion of habitat to intensive human uses have eliminated or reduced some populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Medium

Comments: No major threats have been identified. Locally, conversion of habitat to intensive human uses have eliminated or reduced some populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in many national parks, monuments, and similarly well-protected areas. No direct conservation measures are needed for this species as a whole.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: This species occurs in many national parks, monuments, and similarly well-protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Western fence lizard

The western fence lizard (Sceloporus occidentalis) is a common lizard of California and the surrounding area. Because the ventral abdomen of an adult is characteristically blue, it is also known as the blue-belly.

It is a member of the genus Sceloporus (the spiny lizards).[1]

Taxonomy[edit]

Taxonomy for the western fence lizard has been under much debate. S. occidentalis belongs in the order Squamata (snakes and lizards) and the suborder Iguania. The family in which it belongs is still under scrutiny. The family Phrynosomatidae, along with seven other families, used to be included in the single family Iguanidae, until Frost and Etheridge's (1989) analysis of iguanian systematics suggested the family be divided.[2] Some literature, however, still places the phrynosomatids in Iguanidae.

Six subspecies are recognized, as follows:

  • Island fence lizard, S. o. becki
  • San Joaquin fence lizard, S. o. biseriatus
  • Coast Range fence lizard, S. o. bocourtii
  • Great Basin fence lizard, S. o. longipes
  • Northwestern fence lizard, S. o. occidentalis
  • Sierra fence lizard, ''S. o. taylori

Some authors have raised the island fence lizard to specific rank, Sceloporus becki. However, recent work in molecular systematics has suggested there are four clades and 11 genetically separable populations, and the subspecies will probably have to be redefined.[1]

Identification[edit]

S. o. occidentalis courting on a log

Western fence lizards measure 5.7-8.9 cm (snout-vent length)[3] and a total length of about 21 cm.[4] They are brown to black in color (the brown may be sandy or greenish) and have black stripes on their backs, but their most distinguishing characteristic is their bright blue bellies. The ventral sides of the limbs are yellow.[5] These lizards also have blue patches on their throats. This bright coloration is faint or absent in both females and juveniles. The scales of S. occidentalis are sharply keeled, and between the interparietal and rear of thighs, there are 35-57 scales.[3]

Many other lizards have similar bright-blue coloring. The eastern fence lizard, S. undulatus, instead of having one large patch on its throat, has two small patches.[3] The sagebrush lizard, S. graciosus, lacks yellow limbs and has smaller dorsal scales.[3] S. occidentalis also resembles the side-blotched lizard, Uta stansburiana. However, the axilla of U. stansburiana usually has a black spot behind it and it has a complete gular fold.[3]

Distribution and habitat[edit]

Although California is the heart of the range of this lizard, it is also found in eastern and southwestern Oregon (some populations are found even north of Seattle, WA), as well as in the Columbia River Gorge, southwestern Idaho, Nevada, western Utah, northwestern Baja California, Arizona, and some of the islands off the coast of both California and Baja California.[6]

The western fence lizard occupies a variety of habitats. It is found in grassland, broken chaparral, sagebrush, woodland, coniferous forest, and farmland, and occupies elevations from sea level to 10,800 ft.[3] They generally avoid the harsh desert.

As of now, the western fence lizard is listed as unprotected, and no conservation restrictions apply.[5][5]

Behavior[edit]

The blue ventral side of the lizard, giving it the name "blue belly"

These lizards are commonly seen sunning on paths, rocks, and fence posts, and other high places, which makes them an easy target for predation by snakes, birds, and even some mammals, such as shrews. They protect themselves by employing their fast reflexes, which are common in many other lizards.[5]

The western fence lizard eats spiders and insects.

Like most other lizards, S. occidentalis goes through a period of hibernation during the winter. The length of time and when they emerge varies depending on climate. During the mating season, adult males will defend a home range.[4]

Reproduction[edit]

Western fence lizards mate in the spring, and do not breed until the spring of their second year. Females lay one to three clutches of three to 17 eggs (usually eight) between April and July. The eggs hatch in August.[3][4]

S. o. bocourtii
Closeup of head

Lyme disease[edit]

Studies have shown Lyme disease is lower in areas where the lizards occur. When ticks carrying Lyme disease feed on these lizards' blood (which they commonly do, especially around their ears), a protein in their blood kills the bacterium that causes Lyme disease. The blood inside the ticks' gut is therefore cleansed and no longer carries Lyme disease.[7]

References[edit]

  1. ^ a b "Sceloporus occidentalis". Integrated Taxonomic Information System. Retrieved 6 February 2006. 
  2. ^ Family Phrynosomatidae from Animal Diversity Web
  3. ^ a b c d e f g Stebbins, Robert C. "A Field Guide to Western Reptiles and Amphibians." 3rd ed. Peterson Field Guides, 2003
  4. ^ a b c Sceloporus occidentalis from Idaho Museum of Natural History
  5. ^ a b c d Sceloporus occidentalis from San Diego Natural History Museum
  6. ^ C. Michael Hogan (2008) "Western fence lizard (Sceloporus occidentalis)", Globaltwitcher, ed. Nicklas Stromberg [1]
  7. ^ Lizards that fight Lyme disease from the California Academy of Sciences

See also[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sceloporus occidentalis taylori

Sceloporus occidentalis taylori is a subspecies of the western fence lizard,[1] commonly called the Sierra fence lizard. Several subspecies of the western fence lizard, a species of phrynosomatid lizard, are found in the far western part of North America.[2]The subspecific epithet, taylori, is in honor of American herpetologist Edward Harrison Taylor.[3]


See also

Notes

  1. ^ H.M. Smith, 1995
  2. ^ C.M. Hogan, 2008
  3. ^ Beltz, Ellin. 2006. Scientific and Common Names of the Reptiles and Amphibians of North America - Explained. http://ebeltz.net/herps/biogappx.html.

References

  • Hobart M. Smith (1995) Handbook of Lizards: Lizards of the United States and of Canada, Cornell University Press, 557 pages ISBN 0-8014-8236-4
  • C. Michael Hogan (2008) "Western fence lizard (Sceloporus occidentalis)", Globaltwitcher, ed. Nicklas Stromberg [1]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Specific distinctness of S. occidentalis and S. undulatus is confirmed by their sympatric reproductive isolation in southwestern Utah (Cole 1983, Smith and Chiszar 1989). See Sites et al. (1992) for a review of phylogenetic hypotheses for lizards of the genus Sceloporus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!