Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Adult Komodo dragons are generally solitary, although groups may gather around a kill. They are powerful predators and their voracious appetite has further fuelled their ferocious image. Both carrion and live prey are consumed; adults ambush deer, water buffalo and wild pigs, and carcasses can be detected from up to 10 km away (2). The large powerful jaws tear at prey and large amounts can be eaten with surprising speed, only a small percentage of the kill is discarded (5). Komodo dragons can eat up to 80% of their own body weight at one time (2). Recent research into the feeding behaviour of the Komodo dragon has shown that it is actually venomous, possessing complex venom glands in its jaw, which excrete a variety of toxic substances that prevent blood clotting and lower blood pressure in its prey. In contrast to the elaborate venom injection system used by snakes, the Komodo dragon's venom is administered relatively crudely, seeping into the large wounds made by the teeth. This means that even if the injured animal escapes, it will rapidly succumb to shock and blood loss induced by the venom. It was previously believed that toxic bacteria found in the Komodo dragon's mouth help to take down prey by infecting bite wounds, leading to fatal blood poisoning. However, studies have indicated that this may not be the case, and that the venom is the main agent by which prey is subdued (6). The mating season occurs between May and June (2); males compete for access to receptive females by wrestling, rearing-up on their hind legs supported by their thick, muscular tail (5). In July and August, females lay and then incubate their clutch of around 25 eggs in depressions dug into the ground (4). Eggs incubate for up to nine months before hatching (2). Juveniles are extremely vulnerable to predation and spend their first year of life in the relatively protected habitat of the trees (7). Young dragons will feed on snakes, lizards and rodents (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The Komodo dragons are the largest lizards in the world (4), and with their ancient appearance and evocative name they conjure up the stuff of legends. The heavy-set body is long with stocky legs and a long muscular tail; the scaly skin is greyish-brown all over (4). Dragons from the island of Flores however, are earthen-red in colour with a yellow head (2). Juveniles have a more striking pattern with very variable combinations of bands and speckling in yellow, green, grey and brown (4). Komodos have a well-developed sense of smell and their long, forked yellow tongue resembles the mythical, fire-breathing dragons of their name.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Geographic Range

Varanus komodoensis is found only in the lesser Sunda region of the Indonesian archipelago, including the islands of Komodo, Flores, Rinca, and Padar.

Biogeographic Regions: oriental (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Asia
Distribution: Komodo, Padar, Rintja, Flores, Lesser Sunda region of Indonesia  
Type locality: Komodo Island, Lesser Sunda Islands, Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Indonesia (Komodo, Rintja, Padar, and western Flores Island)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found on the island of Komodo in Indonesia, from which they have received their common name; these dragons are also found on the neighbouring islands of Rinca and Flores (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Komodo dragons are the largest lizards, reaching 165 kg and greater than three meters in length. Juveniles are green with yellow and black bands. Adults dull and uniform in color, from brown to grayish red. Their robust bodies are uniformly covered in rough scales. They have strong limbs and a powerful, muscular tail. The heads of Komodo dragons have a rounded snout and ear openings. Their skulls are flexible and have sharp, serrated teeth. Although males tend to grow larger, there are no obvious morphological differences between the sexes.

Range mass: 165 (high) kg.

Range length: 3.1 (high) m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Adult Komodo dragons live mainly in tropical savannah forests. They prefer open lowland areas with tall grasses and bushes, but are also found in other habitats, such as beaches, ridge tops, and dry riverbeds. Young Komodo dragons are arboreal and live in forested regions until they are eight months old.

Range elevation: 0 to 820 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The three islands where Komodo dragons live are all volcanic; they inhabit the lower monsoon forests and savannah up to about 700 metres above sea level (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

A normal adult Komodo dragon diet consists mainly of carrion, but it is not uncommon for them to attack and eat a variety of large prey, including goats, pigs, deer, wild boar, horses, water buffalo, and smaller Komodo dragons. Komodo dragons hunt larger prey by ambushing them and delivering a bite. They then follow the injured animal until they succumb to either blood loss or infection. The saliva of Komodo dragons is rich in bacteria that rapidly leads to infection in their prey. A recent discovery of venom in the bites of Varanus species implies that venoms may be used in subduing prey also, although specific research on Komodo dragon venom action has not been completed. Juveniles feed on grasshoppers, beetles, small geckos, eggs, birds, and eventually small mammals. Varanus komodoensis is able to swallow large pieces of food by expanding its throat and its flexible skull. They eat most of their prey, leaving very little to be wasted.

Animal Foods: birds; mammals; reptiles; eggs; carrion ; insects

Primary Diet: carnivore (Eats terrestrial vertebrates, Scavenger )

  • Fry, B., N. Vidal, J. Norman. 2006. Early evolution of the venom system in lizards and snakes. Nature, 439: 584-588.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Varanus komodoensis is a top predator in its habitat and one of the largest animals present in the area. It is also a scavenger that eats recently dead animals and removes them from the landscape.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult Komodo dragons are at the top of their food chain and do not have any predators. Juveniles often fall prey to adults, larger mammals, and birds. They avoid predation by being arboreal until they become larger.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Varanus komodoensis preys on:
Cervus timorensis

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Although Varanus komodoensis can see 300 meters away and can hear a restricted range of sound, its sense of smell is its primary method for detecting food and the tip of its tongue is its primary scent detector. Males communicate dominance in mating and feeding order by wrestling in upright positions. Females give off a scent in their feces to communicate that they are ready to mate and the male replies by rubbing his chin on her and licking her body.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Varanus komodoensis hatches from eggs. Young Komodo dragons live in trees to avoid falling prey to older members of the species. They are also much smaller and more sinuous than the adults, allowing them to live in trees. At 8 months, they grow too large to be arboreal, alter their diet, and become terrestrial.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Although many Varanus komodoensis individuals fall prey to other animals as hatchlings, ones that live to adulthood usually have a lifespan of around 50 years.

Average lifespan

Status: wild:
50 years.

Average lifespan

Sex: female

Status: captivity:
8.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (captivity) Observations: Little is known about the lifespan of the Komodo dragon. They appear capable of living at least 25 years in captivity (http://www.zoo.org/). Anecdotal reports of animals living up to 50 years in the wild are plausible but remain unverified.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Males engage in a ritual combat to mate with females. They wrestle in an upright position to try to throw the loser to the ground, often drawing blood. When ready to mate, females give off a scent in their feces that males can detect. Male Komodo dragons then locate the female, rub their chin on her head, scratch her back, and lick her body. If the female exhibits interest, she licks him back. He then grasps her with his claws, lifts her tail with his, and mates with her. After mating, some males will stay with the female for a few days to prevent other males from mating with her.

Mating System: polygynandrous (promiscuous)

The mating season of Varanus komodoensis occurs yearly in July and August. Females lay up to thirty eggs about a month later (September) to avoid the hot summer months and allow a chance for a second mating. The eggs are buried in the earth and take about 8 months to hatch. Hatchlings are about 37 centimeters long and have a high mortality rate, frequently falling prey to adults and other species. As a result, they move to nearby trees as soon as they are able. It is estimated that females reach sexual maturity after 9 years and males reach it after 10 years.

Breeding interval: Varanus komodoensis breeds once yearly, but females will often mate more than once to ensure that their eggs are fertilized.

Breeding season: Breeding occurs from July to September.

Range number of offspring: 30 (high) .

Average gestation period: 8 months.

Average age at sexual or reproductive maturity (female): 9 years.

Average age at sexual or reproductive maturity (male): 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average birth mass: 100 g.

Average gestation period: 49 days.

Average number of offspring: 22.

Average age at sexual or reproductive maturity (male)

Sex: male:
1825 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1825 days.

Female Komodo dragons dig a nest chamber in the ground for their eggs and cover it with earth and leaves. They then lie on the nest while the eggs are incubating, but there is no evidence of any parental care once the eggs hatch.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

  • Ciofi, C., T. Jessop. 2004. Tracing the Dragon. BBC Wildlife: 52-58.
  • 1991. Lizards and Worm Lizards - Sauria and Amphisbaenia. Pp. 1606-1608 in M Corliss Pearl, ed. Reptiles and Amphibians, Vol. 9, 1 Edition. Lakeville, CT: Grey Castle Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Varanus komodoensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC0044-06|AB080275|Varanus komodoensis| ACCCGTTGACTATTCTCTACTAATCATAAGGACATTGGGACCCTGTACCTAATCTTTGGAGCTTGGGCCGGAATAATCGGGACTGCCATA---AGCCTCCTAATTCGAGCTGAGCTAAGTCAGCCCGGAACTATTCTCGGAAAC---GACCAGATCTATAATGTCATTGTAACCGCACACGCACTTGTCATAATTTTCTTCATGGTCATACCTATTATAATTGGAGGTTTCGGAAACTGACTAGTTCCCCTAATG---ATTGGCGCCCCAGACATAGCCTTCCCACGGATAAATAATATGAGCTTCTGACTTCTTCCCCCATCCCTCCTTCTACTTTTAGCCTCAGCCTGAGTAGAAGCTGGGTCAGGGACAGGATGGACTGTGTATCCTCCTCTTGCAGGAAACATAGCCCACGCCGGAGCATCAGTTGATTTG---ACAATCTTCTCCCTCCACCTGGCAGGAGTCTCATCCATTCTTGGGGCCATCAACTTCATTACCACCTGCATCAACATAAAACCCCCCACAATAACTCAATACCATATGCCCTTATTTGTCTGATCCGTACTAATCACCGCAGTCCTCCTCCTCCTCTCACTGCCAGTCCTGGCTGCA---GGAATCACAATGCTTCTCACTGACCGCAATCTAAACACTTCCTTCTTTGATCCAGCCGGCGGTGGAGATCCCATTCTTTATCAACACCTATTCTGATTTTTTGGACACCCAGAAGTTTACATCTTAATCCTACCTGGATTCGGAATAATTTCCCACATCATTTCCTATTACTCTAACAAAAAA---GAACCATTCGGCTATATAGGAATGGTTTGAGCCATAATATCAATTGGACTACTAGGATTCCTAGTATGAGCCCACCACATATTTACCGTGGGTATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Varanus komodoensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1+2cde

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
World Conservation Monitoring Centre

Reviewer/s

Contributor/s

History
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Komodo dragons are currently classified as endangered throughout their range. This status is the result of a combination of prey depletion, poaching, and habitat encroachment by humans.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

  • Cohn, J. 1994. Indonesian treasure has a Jurassic appeal. BioScience, 44: 40-44.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Varanus komodoensis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

The population of Komodo dragons today is estimated to be a mere fraction of its size 50 years ago (4). Causes of this decline are widespread habitat loss throughout the region, a loss of prey species and hunting (4). No Komodo dragons have been seen on the island of Padar since the 1970s, the result of widespread poaching of the deer that constitute their chief prey source (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Komodo and surrounding islands lie within the Komodo National Park (5). Law has protected these dragons since the 1930s (4), and international trade is prohibited by their listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3). An important tourist trade has sprung-up around these spectacular creatures, bringing over 18,000 visitors to the area each year; it is hoped that this economic incentive will help to safeguard the future of these awesome dragons (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Varanus komodoensis individuals have been known to attack and kill humans in a few rare occurrences. They also have attacked and harmed livestock in the area.

Negative Impacts: injures humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Komodo dragons are an important ecotourism draw. Scientists are also conducting studies on how they are able have strains of lethal bacteria living in their saliva without being affected by them.

Positive Impacts: ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Komodo dragon

The Komodo dragon (Varanus komodoensis), also known as the Komodo monitor, is a large species of lizard found in the Indonesian islands of Komodo, Rinca, Flores, Gili Motang and Padar.[4] A member of the monitor lizard family (Varanidae), it is the largest living species of lizard, growing to a maximum length of 3 metres (10 ft) in rare cases and weighing up to around 70 kilograms (150 lb).[4] Their unusual size has been attributed to island gigantism, since there are no other carnivorous animals to fill the niche on the islands where they live.[5][6]

However, recent research suggests that the large size of Komodo dragons may be better understood as representative of a relict population of very large varanid lizards that once lived across Indonesia and Australia, most of which, along with other megafauna,[7] died out after the Pleistocene. Fossils very similar to V. komodoensis have been found in Australia dating to greater than 3.8 million years ago, and its body size remained stable on Flores, one of the handful of Indonesian islands where it is currently found, over the last 900,000 years, "a time marked by major faunal turnovers, extinction of the island's megafauna, and the arrival of early hominids by 880 ka."[7]

As a result of their size, these lizards dominate the ecosystems in which they live.[8] Komodo dragons hunt and ambush prey including invertebrates, birds, and mammals. Their group behaviour in hunting is exceptional in the reptile world. The diet of big Komodo dragons mainly consists of deer, though they also eat considerable amounts of carrion.[4]

Mating begins between May and August, and the eggs are laid in September. About twenty eggs are deposited in abandoned megapode nests or in a self-dug nesting hole.[4] The eggs are incubated for seven to eight months, hatching in April, when insects are most plentiful. Young Komodo dragons are vulnerable and therefore dwell in trees, safe from predators and cannibalistic adults. They take about eight to nine years to mature, and are estimated to live for up to 30 years.[4]

Komodo dragons were first recorded by Western scientists in 1910.[9] Their large size and fearsome reputation make them popular zoo exhibits. In the wild their range has contracted due to human activities and they are listed as vulnerable by the IUCN.[2] They are protected under Indonesian law, and a national park, Komodo National Park, was founded to aid protection efforts.

Contents

Etymology

The Komodo dragon is also known as the Komodo monitor or the Komodo Island monitor in scientific literature,[1] although this is not very common. To the natives of Komodo Island, it is referred to as ora, buaya darat (land crocodile) or biawak raksasa (giant monitor).[10][11]

Evolutionary history

The evolutionary development of the Komodo dragon started with the Varanus genus, which originated in Asia about 40 million years ago and migrated to Australia. Around 15 million years ago, a collision between Australia and Southeast Asia allowed the varanids to move into what is now the Indonesian archipelago, extending their range as far east as the island of Timor. The Komodo dragon was believed to have differentiated from its Australian ancestors 4 million years ago. However, recent fossil evidence from Queensland suggests that the Komodo dragon evolved in Australia before spreading to Indonesia.[7][12] Dramatic lowering of sea level during the last glacial period uncovered extensive stretches of continental shelf that the Komodo dragon colonized, becoming isolated in their present island range as sea levels rose afterwards.[7][11]

Description

Closeup of a Komodo dragon's skin

In the wild, an adult Komodo dragon usually weighs around 70 kilograms (150 lb),[13] although captive specimens often weigh more. The largest verified wild specimen was 3.13 metres (10 ft 3 in) long and weighed 166 kilograms (370 lb), including undigested food.[11] The Komodo dragon has a tail as long as its body, as well as about 60 frequently replaced serrated teeth that can measure up to 2.5 centimetres (1 in) in length. Its saliva is frequently blood-tinged, because its teeth are almost completely covered by gingival tissue that is naturally lacerated during feeding.[14] This creates an ideal culture for the bacteria that live in its mouth.[15] It also has a long, yellow, deeply forked tongue.[11]


Senses

The Komodo dragon does not have an acute sense of hearing, despite its visible earholes, and is only able to hear sounds between 400 and 2000 hertz.[11][16] It is able to see as far away as 300 metres (980 ft), but because its retinas only contain cones, it is thought to have poor night vision. The Komodo dragon is able to see in color, but has poor visual discrimination of stationary objects.[17]

Komodo dragons video.wmv.OGG
A Komodo dragon on Komodo Island uses its tongue to sample the air

The Komodo dragon uses its tongue to detect, taste, and smell stimuli, as with many other reptiles, with the vomeronasal sense using the Jacobson's organ, rather than using the nostrils.[15] With the help of a favorable wind and its habit of swinging its head from side to side as it walks, Komodo dragons may be able to detect carrion from 4–9.5 kilometres (2.5–5.9 mi) away.[17] It only has a few taste buds in the back of its throat.[15] Its scales, some of which are reinforced with bone, have sensory plaques connected to nerves that facilitate its sense of touch. The scales around the ears, lips, chin, and soles of the feet may have three or more sensory plaques.[14]

The Komodo dragon was formerly thought to be deaf when a study reported no agitation in wild Komodo dragons in response to whispers, raised voices, or shouts. This was disputed when London Zoological Garden employee Joan Proctor trained a captive specimen to come out to feed at the sound of her voice, even when she could not be seen.[18]

Ecology

Foot and tail

The Komodo dragon prefers hot and dry places, and typically lives in dry open grassland, savanna, and tropical forest at low elevations. As an ectotherm, it is most active in the day, although it exhibits some nocturnal activity. Komodo dragons are solitary, coming together only to breed and eat. They are capable of running rapidly in brief sprints up to 20 kilometres per hour (12 mph), diving up to 4.5 metres (15 ft), and climbing trees proficiently when young through use of their strong claws.[13] To catch prey that is out of reach, the Komodo dragon may stand on its hind legs and use its tail as a support.[18] As the Komodo dragon matures, its claws are used primarily as weapons, as its great size makes climbing impractical.[14]

For shelter, the Komodo dragon digs holes that can measure from 1–3 metres (3–10 ft) wide with its powerful forelimbs and claws.[19] Because of its large size and habit of sleeping in these burrows, it is able to conserve body heat throughout the night and minimize its basking period the morning after.[20] The Komodo dragon hunts in the afternoon, but stays in the shade during the hottest part of the day.[21] These special resting places, usually located on ridges with a cool sea breeze, are marked with droppings and are cleared of vegetation. They serve as a strategic location from which to ambush deer.[22]

Diet

Komodo dragons on Rinca

Komodo dragons are carnivores. Although they eat mostly carrion,[5] they will also ambush live prey with a stealthy approach. When suitable prey arrives near a dragon's ambush site, it will suddenly charge at the animal and go for the underside or the throat.[14] It is able to locate its prey using its keen sense of smell, which can locate a dead or dying animal from a range of up to 9.5 kilometres (6 mi). Komodo dragons have been observed knocking down large pigs and deer with their strong tail.[23][24]

Komodo dragons eat by tearing large chunks of flesh and swallowing them whole while holding the carcass down with their forelegs. For smaller prey up to the size of a goat, their loosely articulated jaws, flexible skull, and expandable stomach allow it to swallow its prey whole. The vegetable contents of the stomach and intestines are typically avoided.[22] Copious amounts of red saliva that the Komodo dragons produce help to lubricate the food, but swallowing is still a long process (15–20 minutes to swallow a goat). A Komodo dragon may attempt to speed up the process by ramming the carcass against a tree to force it down its throat, sometimes ramming so forcefully that the tree is knocked down.[22] To prevent itself from suffocating while swallowing, it breathes using a small tube under the tongue that connects to the lungs.[14] After eating up to 80 percent of its body weight in one meal,[8] it drags itself to a sunny location to speed digestion, as the food could rot and poison the dragon if left undigested for too long. Because of their slow metabolism, large dragons can survive on as little as 12 meals a year.[14] After digestion, the Komodo dragon regurgitates a mass of horns, hair, and teeth known as the gastric pellet, which is covered in malodorous mucus. After regurgitating the gastric pellet, it rubs its face in the dirt or on bushes to get rid of the mucus, suggesting that it, like humans, does not relish the scent of its own excretions.[14]

A young Komodo dragon photographed on Rinca feeding on a water buffalo carcass

The largest animals eat first, while the smaller ones follow a hierarchy. The largest male asserts his dominance and the smaller males show their submission by use of body language and rumbling hisses. Dragons of equal size may resort to "wrestling". Losers usually retreat though they have been known to be killed and eaten by victors.[25]

Komodo excrement is mostly white as the stomach is not capable of digesting the calcium found in the bones of the animals they eat.

The Komodo dragon's diet is wide-ranging, and includes invertebrates, other reptiles (including smaller Komodo dragons), birds, bird eggs, small mammals, monkeys, wild boar, goats, deer, horses, and water buffalo.[26] Young Komodos will eat insects, eggs, geckos, and small mammals.[5] Occasionally they consume humans and human corpses, digging up bodies from shallow graves.[18] This habit of raiding graves caused the villagers of Komodo to move their graves from sandy to clay ground and pile rocks on top of them to deter the lizards.[22] The Komodo dragon may have evolved to feed on the extinct dwarf elephant Stegodon that once lived on Flores, according to evolutionary biologist Jared Diamond.[27]

The Komodo dragon drinks by sucking water into its mouth via buccal pumping (a process also used for respiration), lifting its head, and letting the water run down its throat.[24]

Saliva

A sleeping Komodo dragon. Its large, curved claws are used in fighting and eating.

Auffenberg described the Komodo dragon as having septic pathogens in its saliva (he described the saliva as "reddish and copious"), specifically the bacteria: E. coli, Staphylococcus sp., Providencia sp., Proteus morgani and P. mirabilis.[25] He noted that while these pathogens can be found in the mouths of wild Komodo dragons, they disappear from the mouths of captive animals, due to a cleaner diet and the use of antibiotics.[25][28] This was verified by taking mucous samples from the external gum surface of the upper jaw of two freshly captured individuals.[25][28] Saliva samples were analyzed by researchers at the University of Texas who found 57 strains of bacteria growing in the mouths of three wild Komodo dragons including Pasteurella multocida.[11][29] The rapid growth of these bacteria was noted by Fredeking: "Normally it takes about three days for a sample of P. multocida to cover a petri dish; ours took eight hours. We were very taken aback by how virulent these strains were".[30] This study supported the observation that wounds inflicted by the Komodo dragon are often associated with sepsis and subsequent infections in prey animals.[29] How the Komodo dragon is unaffected by these virulent bacteria remains a mystery.[30]

In late 2005, researchers at the University of Melbourne speculated that the perentie (Varanus giganteus), other species of monitor, and agamids may be somewhat venomous. The team believes that the immediate effects of bites from these lizards were caused by mild envenomation. Bites on human digits by a lace monitor (V. varius), a Komodo dragon, and a spotted tree monitor (V. scalaris) all produced similar effects: rapid swelling, localized disruption of blood clotting, and shooting pain up to the elbow, with some symptoms lasting for several hours.[31]

In 2009, the same researchers published further evidence demonstrating that Komodo dragons possess a venomous bite. MRI scans of a preserved skull showed the presence of two venom glands in the lower jaw. They extracted one of these glands from the head of a terminally ill specimen in the Singapore Zoological Gardens, and found that it secreted a venom containing several different toxic proteins. The known functions of these proteins include inhibition of blood clotting, lowering of blood pressure, muscle paralysis, and the induction of hypothermia, leading to shock and loss of consciousness in envenomated prey.[32][33] As a result of the discovery, the previous theory that bacteria were responsible for the deaths of Komodo victims was disputed.[34]

Kurt Schwenk, an evolutionary biologist at the University of Connecticut, finds the discovery of these glands intriguing, but considers most of the evidence for venom in the study to be "meaningless, irrelevant, incorrect or falsely misleading". Even if the lizards have venomlike proteins in their mouths, Schwenk argues, they may be using them for a different function, and he doubts that venom is necessary to explain the effect of a Komodo dragon bite, arguing that shock and blood loss are the primary factors.[35][36]

Reproduction

Mating occurs between May and August, with the eggs laid in September.[11] During this period, males fight over females and territory by grappling with one another upon their hind legs with the loser eventually being pinned to the ground. These males may vomit or defecate when preparing for the fight.[18] The winner of the fight will then flick his long tongue at the female to gain information about her receptivity.[8] Females are antagonistic and resist with their claws and teeth during the early phases of courtship. Therefore, the male must fully restrain the female during coitus to avoid being hurt. Other courtship displays include males rubbing their chins on the female, hard scratches to the back, and licking.[37] Copulation occurs when the male inserts one of his hemipenes into the female's cloaca.[17] Komodo dragons may be monogamous and form "pair bonds", a rare behavior for lizards.[18]

A Komodo dragon with its long tail and claws fully visible

The female lays her eggs in burrows cut into the side of a hill or in the abandoned nesting mounds of the Orange-footed Scrubfowl (a moundbuilder or megapode), with a preference for the abandoned mounds.[38] Clutches contain an average of 20 eggs which have an incubation period of 7–8 months.[18] Hatching is an exhausting effort for the neonates, who break out of their eggshells with an egg tooth that falls off soon after. After cutting out the hatchlings may lie in their eggshells for hours before starting to dig out of the nest. They are born quite defenseless, and many are eaten by predators.[25]

Young Komodo dragons spend much of their first few years in trees, where they are relatively safe from predators, including cannibalistic adults, who make juvenile dragons 10% of their diet.[18] According to David Attenborough, the habit of cannibalism may be advantageous in sustaining the large size of adults, as medium-sized prey on the islands is rare.[23] When the young must approach a kill, they roll around in fecal matter and rest in the intestines of eviscerated animals to deter these hungry adults.[18] Komodo dragons take about three to five years to mature, and may live for up to 50 years.[19]

Parthenogenesis

A parthenogenetic baby Komodo dragon, Chester Zoo, England

A Komodo dragon at London Zoo named Sungai laid a clutch of eggs in late 2005 after being separated from male company for more than two years. Scientists initially assumed that she had been able to store sperm from her earlier encounter with a male, an adaptation known as superfecundation.[39] On December 20, 2006, it was reported that Flora, a captive Komodo dragon living in the Chester Zoo in England, was the second known Komodo dragon to have laid unfertilized eggs: she laid 11 eggs, and seven of them hatched, all of them male.[40] Scientists at Liverpool University in England performed genetic tests on three eggs that collapsed after being moved to an incubator, and verified that Flora had never been in physical contact with a male dragon. After Flora's eggs' condition had been discovered, testing showed that Sungai's eggs were also produced without outside fertilization.[41] On January 31, 2008, the Sedgwick County Zoo in Wichita, Kansas became the first zoo in the Americas to document parthenogenesis in Komodo dragons. The zoo has two adult female Komodo dragons, one of which laid about 17 eggs on May 19–20, 2007. Only two eggs were incubated and hatched due to space issues; the first hatched on January 31, 2008 while the second hatched on February 1. Both hatchlings were males.[42][43]

Komodo dragons have the ZW chromosomal sex-determination system, as opposed to the mammalian XY system. Male progeny prove that Flora's unfertilized eggs were haploid (n) and doubled their chromosomes later to become diploid (2n) (by being fertilized by a polar body, or by chromosome duplication without cell division), rather than by her laying diploid eggs by one of the meiosis reduction-divisions in her ovaries failing. When a female Komodo dragon (with ZW sex chromosomes) reproduces in this manner, she provides her progeny with only one chromosome from each of her pairs of chromosomes, including only one of her two sex chromosomes. This single set of chromosomes is duplicated in the egg, which develops parthenogenetically. Eggs receiving a Z chromosome become ZZ (male); those receiving a W chromosome become WW and fail to develop.[44][45]

It has been hypothesized that this reproductive adaptation allows a single female to enter an isolated ecological niche (such as an island) and by parthenogenesis produce male offspring, thereby establishing a sexually reproducing population (via reproduction with her offspring that can result in both male and female young).[44] Despite the advantages of such an adaptation, zoos are cautioned that parthenogenesis may be detrimental to genetic diversity.[46]

History

Discovery by the Western world

Komodo dragon coin, issued by Indonesia

Komodo dragons were first documented by Europeans in 1910, when rumors of a "land crocodile" reached Lieutenant van Steyn van Hensbroek of the Dutch colonial administration.[47] Widespread notoriety came after 1912, when Peter Ouwens, the director of the Zoological Museum at Bogor, Java, published a paper on the topic after receiving a photo and a skin from the lieutenant, as well as two other specimens from a collector.[3] Later, the Komodo dragon was the driving factor for an expedition to Komodo Island by W. Douglas Burden in 1926. After returning with 12 preserved specimens and 2 live ones, this expedition provided the inspiration for the 1933 movie King Kong.[48] It was also Burden who coined the common name "Komodo dragon."[21] Three of his specimens were stuffed and are still on display in the American Museum of Natural History.[49]

Studies

Komodo in the emblem of East Nusa Tenggara province

The Dutch, realizing the limited number of individuals in the wild, outlawed sport hunting and heavily limited the number of individuals taken for scientific study. Collecting expeditions ground to a halt with the occurrence of World War II, not resuming until the 1950s and 1960s, when studies examined the Komodo dragon's feeding behavior, reproduction, and body temperature. At around this time, an expedition was planned in which a long-term study of the Komodo dragon would be undertaken. This task was given to the Auffenberg family, who stayed on Komodo Island for 11 months in 1969. During their stay, Walter Auffenberg and his assistant Putra Sastrawan captured and tagged more than 50 Komodo dragons.[30] The research from the Auffenberg expedition would prove to be enormously influential in raising Komodo dragons in captivity.[50] Research after the Auffenberg family has shed more light on the nature of the Komodo dragon, with biologists such as Claudio Ciofi continuing to study the creatures.[51]

Conservation

A basking Komodo dragon photographed at Disney's Animal Kingdom.

The Komodo dragon is a vulnerable species and is found on the IUCN Red List.[2] There are approximately 4,000 to 5,000 living Komodo dragons in the wild. Their populations are restricted to the islands of Gili Motang (100), Gili Dasami (100), Rinca (1,300), Komodo (1,700), and Flores (perhaps 2,000).[50] However, there are concerns that there may presently be only 350 breeding females.[10] To address these concerns, the Komodo National Park was founded in 1980 to protect Komodo dragon populations on islands including Komodo, Rinca, and Padar.[52] Later, the Wae Wuul and Wolo Tado Reserves were opened on Flores to aid with Komodo dragon conservation.[51]

Komodo dragons avoid encounters with humans. Juveniles are very shy and will flee quickly into a hideout if a human comes closer than about 100 metres (330 ft). Older animals will also retreat from humans from a shorter distance away. If cornered, they will react aggressively by gaping their mouth, hissing, and swinging their tail. If they are disturbed further, they may start an attack and bite. Although there are anecdotes of unprovoked Komodo dragons attacking or preying on humans, most of these reports are either not reputable or caused by defensive bites. Only a very few cases are truly the result of unprovoked attacks by abnormal individuals which lost their fear towards humans.[25]

Volcanic activity, earthquakes, loss of habitat, fire,[14][51] loss of prey due to poaching, tourism, and illegal poaching of the dragons themselves have all contributed to the vulnerable status of the Komodo dragon. Under Appendix I of CITES (the Convention on International Trade in Endangered Species), commercial trade of skins or specimens is illegal.[53][54]

On Padar, a former population of the Komodo Dragon became extinct, of which the last individuals were seen in 1975.[55] It is widely assumed that the Komodo dragon died out on Padar after a strong decline of the populations of large ungulate prey, for which poaching was most likely responsible.[56]

In captivity

A Komodo dragon at Smithsonian National Zoological Park. Despite the visible earholes, Komodo dragons cannot hear very well.

Komodo dragons have long been great zoo attractions, where their size and reputation make them popular exhibits. They are, however, rare in zoos because they are susceptible to infection and parasitic disease if captured from the wild, and do not readily reproduce.[10] In May 2009, there were thirteen European, two African, thirty-five North American, one Singaporean and two Australian institutions that kept Komodo dragons.[57]

The first Komodo dragon was exhibited in 1934 at the Smithsonian National Zoological Park, but it lived for only two years. More attempts to exhibit Komodo dragons were made, but the lifespan of these creatures was very short, averaging five years in the National Zoological Park. Studies done by Walter Auffenberg, which were documented in his book The Behavioral Ecology of the Komodo Monitor, eventually allowed for more successful managing and reproducing of the dragons in captivity.[50]

A variety of behaviors have been observed from captive specimens. Most individuals are relatively tame within a short period of time,[58][59] and are capable of recognizing individual humans and discriminating between more familiar keepers.[60] Komodo dragons have also been observed to engage in play with a variety of objects, including shovels, cans, plastic rings, and shoes. This behavior does not seem to be "food-motivated predatory behavior".[8][11][61]

Even seemingly docile dragons may become aggressive unpredictably, especially when the animal's territory is invaded by someone unfamiliar. In June 2001, a Komodo dragon seriously injured a man when he entered its enclosure at the Los Angeles Zoo after being invited in by its keeper. He was bitten on his bare foot, as the keeper had told him to take off his white shoes, which could have potentially excited the Komodo dragon.[62][63] Although he escaped, he needed to have several tendons in his foot reattached surgically.[64]

See also

References

  1. ^ a b "Varanus komodoensis". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=202168. Retrieved 19 June 2007. 
  2. ^ a b c World Conservation Monitoring Centre (1996). "Varanus komodoensis". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/22884. Retrieved 9 August 2011. 
  3. ^ a b Ouwens, P.A. (1912). "On a large Varanus species from the island of Komodo". Bull. Jard. Bot. Buit. 2 (6): 1–3. 
  4. ^ a b c d e Ciofi, Claudio (2004). Varanus komodoensis. Bloomington & Indianapolis: Indiana University Press. pp. 197–204. ISBN 0-253-34366-6. 
  5. ^ a b c Chris Mattison, (1989 & 1992). Lizards of the World. New York: Facts on File. pp. 16, 57, 99, 175. ISBN 0-8160-5716-8. 
  6. ^ Burness G, Diamond J, Flannery T (Dec 2001). "Dinosaurs, dragons, and dwarfs: The evolution of maximal body size" (Free full text). Proc Natl Acad Sci USA 98 (25): 14518–23. doi:10.1073/pnas.251548698. ISSN 0027-8424. PMC 64714. PMID 11724953. http://www.pnas.org/cgi/pmidlookup?view=long&pmid=11724953. 
  7. ^ a b c d Hocknull SA, Piper PJ, van den Bergh GD, Due RA, Morwood MJ, Kurniawan I (September 2009). Turvey, Samuel T.. ed. "Dragon's Paradise Lost: Palaeobiogeography, Evolution and Extinction of the Largest-Ever Terrestrial Lizards (Varanidae)" (Free full text). PLoS ONE 4 (9): e7241. doi:10.1371/journal.pone.0007241. PMC 2748693. PMID 19789642. http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0007241. 
  8. ^ a b c d Tim Halliday (Editor), Kraig Adler (Editor) (2002). Firefly Encyclopedia of Reptiles and Amphibians. Hove: Firefly Books Ltd. pp. 112, 113, 144, 147, 168, 169. ISBN 1-55297-613-0. 
  9. ^ Mampam.com
  10. ^ a b c "Endangered! Ora". American Museum of Natural History. http://www.amnh.org/nationalcenter/Endangered/ora/ora.html. Retrieved 2007-01-15. 
  11. ^ a b c d e f g h Ciofi, Claudio. "The Komodo Dragon". Scientific American. http://www.sciam.com/article.cfm?id=the-komodo-dragon. Retrieved 2006-12-21. 
  12. ^ "Australia was 'hothouse' for killer lizards", ABC, September 30, 2009. Retrieved on September 30, 2009.
  13. ^ a b Burnie, David; Don E. Wilson (2001). Animal. New York: DK Publishing. pp. 417, 420. ISBN 0-7894-7764-5. 
  14. ^ a b c d e f g h Tara Darling (Illustrator). Komodo Dragon: On Location (Darling, Kathy. on Location.). Lothrop, Lee and Shepard Books. ISBN 0-688-13777-6. 
  15. ^ a b c "Komodo Dragon". Singapore Zoological Gardens. Archived from the original on 2006-11-27. http://web.archive.org/web/20061127173608/http://www.szgdocent.org/resource/rr/c-komodo.htm. Retrieved 2006-12-21. 
  16. ^ "Komodo Conundrum". BBC. Archived from the original on 2006-11-16. http://web.archive.org/web/20061116030327/http://www.bbc.co.uk/nature/animals/features/336feature1.shtml. Retrieved 2007-11-25. 
  17. ^ a b c "Komodo Dragon Fact Sheet". National Zoo. http://nationalzoo.si.edu/Animals/ReptilesAmphibians/Facts/FactSheets/Komododragon.cfm. Retrieved 2007-11-25. 
  18. ^ a b c d e f g h David Badger; photography by John Netherton (2002). Lizards: A Natural History of Some Uncommon Creatures, Extraordinary Chameleons, Iguanas, Geckos, and More. Stillwater, MN: Voyageur Press. pp. 32, 52, 78, 81, 84, 140–145, 151. ISBN 0-89658-520-4. 
  19. ^ a b consultant editors, Harold G. Cogger & Richard G. Zweifel; illustrations by David Kirshner (1998). Encyclopedia of Reptiles & Amphibians. Boston: Academic Press. pp. 132, 157–8. ISBN 0-12-178560-2. 
  20. ^ Eric R. Pianka and Laurie J. Vitt; with a foreword by Harry W. Greene (2003). Lizards: Windows to the Evolution of Diversity. Berkeley: University of California Press. p. 244. ISBN 0-520-23401-4. 
  21. ^ a b "Komodo National Park Frequently Asked Questions". Komodo Foundation. http://www.komodo-gateway.org/faq1.html. Retrieved 2007-10-25. 
  22. ^ a b c d Alison Ballance; Morris, Rod (2003). South Sea Islands: A Natural History. Hove: Firefly Books Ltd. ISBN 1-55297-609-2. 
  23. ^ a b Attenborough, David (2008). Life in Cold Blood. Princeton, N.J: Princeton University Press. ISBN 0-691-13718-8. 
  24. ^ a b Auffenberg, Walter (1981). The Behavioral Ecology of the Komodo Monitor. Gainesville, Florida: University Presses of Florida. ISBN 0-8130-0621-X. 
  25. ^ a b c d e f Auffenberg, Walter (1981). The Behavioral Ecology of the Komodo Monitor. Gainesville: University Presses of Florida. p. 406. ISBN 0-8130-0621-X. 
  26. ^ Vidal, John (2008-06-12). "The terrifying truth about Komodo dragons". London: guardian.co.uk. http://www.guardian.co.uk/world/2008/jun/12/indonesia. Retrieved 2008-06-19. 
  27. ^ Diamond, Jared M. (1987). "Did Komodo dragons evolve to eat pygmy elephants?". Nature 326 (6116): 832. doi:10.1038/326832a0. 
  28. ^ a b Balsai, Michael Joseph (2001). The phylogenetic position of Palaeosaniwa and the early evolution of the Platynotan (Varanoid) anguimorphs (January 1, 2001). University of Pennsylvania - Electronic Dissertations. Paper AAI3031637. UPENN.edu
  29. ^ a b Montgomery, JM; D Gillespie, P Sastrawan, TM Fredeking, and GL Stewart (2002). "Aerobic salivary bacteria in wild and captive Komodo dragons". Journal of Wildlife Diseases (Wildlife Disease Association) 38 (3): 545–551. PMID 12238371. http://www.jwildlifedis.org/cgi/reprint/38/3/545.pdf. Retrieved 2009-05-29. 
  30. ^ a b c Cheater, Mark (August/September 2003). "Chasing the Magic Dragon". National Wildlife Magazine (National Wildlife Federation) 41 (5). http://www.nwf.org/nationalwildlife/article.cfm?articleId=810&issueId=63. 
  31. ^ Fry, BG et al (February 2006). "Early evolution of the venom system in lizards and snakes" (PDF). Nature 439 (7076): 584–588. doi:10.1038/nature04328. ISSN 0028-0836. PMID 16292255. http://www.nature.com/nature/journal/v439/n7076/abs/nature04328.html. 
  32. ^ Scientists discover deadly secret of Komodo's bite, AFP, May 19, 2009
  33. ^ Bryan G. Fry, Stephen Wroec, Wouter Teeuwissed, et al., (University of Melbourne): PNAS, published online, doi:10.1073/pnas.0810883106, "A central role for venom in predation by Varanus komodoensis (Komodo Dragon) and the extinct giant Varanus (Megalania) priscus"
  34. ^ Staff. "Komodo dragons kill with venom, not bacteria, study says". CNN. May 20, 2009. Retrieved on May 25, 2009.
  35. ^ Zimmer, Carl (May 2009). "Venom Might Boost Dragons Bite". San Diego Tribune. http://www3.signonsandiego.com/stories/2009/may/25/1c25komodo183628-venom-may-be-boost-dragons-bite/?uniontrib. Retrieved 2009-09-26. 
  36. ^ Zimmer, Carl (May 18, 2009). "Chemicals in Dragon's Glands Stir Venom Debate". New York Times: p. D2. http://www.nytimes.com/2009/05/19/science/19komo.html. Retrieved 2012-03-23. 
  37. ^ "Komodo Dragon, Varanus komodoensis". San Diego Zoo. http://library.sandiegozoo.org/factsheets/komodo_dragon/komodo.htm. Retrieved 2009-10-27. 
  38. ^ Jessop, Tim S., et al.. "Distribution, Use and Selection of Nest Type by Komodo Dragons" (PDF). Elsevier. Archived from the original on 2007-08-29. http://web.archive.org/web/20070829154723/http://www.komododragon.biz/uploads/downloads/jessop+et+al+2004e.pdf. Retrieved 2008-03-13. 
  39. ^ Morales, Alex (2006-12-20). "Komodo Dragons, World's Largest Lizards, Have Virgin Births". Bloomberg Television. http://www.bloomberg.com/apps/news?pid=20601082&sid=apLYpeppu8ag&refer=canada. Retrieved 2008-03-28. 
  40. ^ Notice by her cage in Chester Zoo in England
  41. ^ Henderson, Mark (2006-12-21). "Wise men testify to Dragon's virgin birth". The Times (London). http://www.timesonline.co.uk/tol/news/uk/article759338.ece. Retrieved 2007-11-26. 
  42. ^ "Recent News - Sedgwick County Zoo". Sedgwick County Zoo. Archived from the original on 2008-02-11. http://web.archive.org/web/20080211184900/http://www.scz.org/n_recent.html. Retrieved 2008-02-12. 
  43. ^ "Komodo dragons hatch with no male involved". MSNBC. http://www.msnbc.msn.com/id/23058689/. Retrieved 2008-02-12. 
  44. ^ a b "Virgin births for giant lizards". BBC News. 2006-12-20. http://news.bbc.co.uk/2/hi/science/nature/6196225.stm. Retrieved 2008-03-13. 
  45. ^ "Strange but True: Komodo Dragons Show that "Virgin Births" Are Possible: Scientific American". Scientific American. http://www.sciam.com/article.cfm?id=strange-but-true-komodo-d. Retrieved 2008-03-24. 
  46. ^ Watts PC, Buley KR, Sanderson S, Boardman W, Ciofi C, Gibson R (Dec 2006). "Parthenogenesis in Komodo Dragons". Nature 444 (7122): 1021–2. doi:10.1038/4441021a. ISSN 0028-0836. PMID 17183308. 
  47. ^ Daily Mail - Should we really be scared of the Komodo dragon?
  48. ^ Rony, Fatimah Tobing (1996). The third eye: race, cinema, and ethnographic spectacle. Durham, N.C: Duke University Press. p. 164. ISBN 0-8223-1840-7. 
  49. ^ "American Museum of Natural History: Komodo Dragons". American Museum of Natural History. http://www.amnh.org/exhibitions/expeditions/treasure_fossil/Treasures/Komodo_Dragons/komodo.html?aa. Retrieved 2007-06-07. 
  50. ^ a b c Trooper Walsh; Murphy, James Jerome; Claudio Ciofi; Colomba De LA Panouse (2002). Komodo Dragons: Biology and Conservation (Zoo and Aquarium Biology and Conservation Series). Washington, D.C.: Smithsonian Books. ISBN 1-58834-073-2. 
  51. ^ a b c "Trapping Komodo Dragons for Conservation". National Geographic. http://news.nationalgeographic.com/news/2003/01/0129_030129_komodo.html. Retrieved 2007-11-08. 
  52. ^ "The official website of Komodo National Park, Indonesia". Komodo National Park. http://www.komodonationalpark.org/. Retrieved 2007-02-02. 
  53. ^ "Zipcodezoo: Varanus komodoensis (Komodo Dragon, Komodo Island Monitor, Komodo Monitor)". BayScience Foundation, Inc.. http://zipcodezoo.com/Animals/V/Varanus_komodoensis. Retrieved 2009-10-25. 
  54. ^ "Appendices I, II and III". CITES. Archived from the original on 2008-03-11. http://web.archive.org/web/20080311055724/http://www.cites.org/eng/app/appendices.shtml. Retrieved 2008-03-24. 
  55. ^ Lilley, R. P. H. (1995). "A feasibility study on the in-situ captive breeding of Komodo dragons (Varanus komodoensis) on Padar Island, Komodo National Park". MSc. Thesis: University of Kent, Canterbury, UK 
  56. ^ Jessop, T.S.; Forsyth, D.M., Purwandana, D., Imansyah, M.J., Opat, D.S., and McDonald-Madden, E. (2005) (PDF). Monitoring the ungulate prey of komodo dragons (Varanus komodoensis) using faecal counts. Zoological Society of San Diego, USA, and the Komodo National Park Authority, Labuan Bajo, Flores, Indonesia. p. 26. http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.172.2230&rep=rep1&type=pdf. Retrieved 2011-03-31. 
  57. ^ "ISIS Abstracts". ISIS. http://app.isis.org/abstracts/Abs50024.asp. Retrieved 2009-01-04. 
  58. ^ Procter, J.B. (October 1928). "On a living Komodo Dragon Varanus komodoensis Ouwens, exhibited at the Scientific Meeting". Proc. Zool. Soc. London: 1017–1019. 
  59. ^ Lederer, G. (1931). "Erkennen wechselwarme Tiere ihren Pfleger?". Wochenschr. Aquar.-Terrarienkunde 28: 636–638. 
  60. ^ Murphy, James B.; Walsh, Trooper (2006). "Dragons and Humans". Herpetological Review 37 (3): 269–275. 
  61. ^ <Please add first missing authors to populate metadata.> (August 2002). "Such jokers, those Komodo dragons". Science News 78 (1): 78. 
  62. ^ Cagle, Jess (2001-06-23). "Transcript: Sharon Stone vs. the Komodo Dragon". Time. http://www.time.com/time/sampler/article/0,8599,133163,00.html. Retrieved 2008-03-20. 
  63. ^ Phillip T. Robinson (2004). Life at the Zoo: Behind the Scenes with the Animal Doctors. New York: Columbia University Press. p. 79. ISBN 0-231-13248-4. 
  64. ^ Pence, Angelica (2001-06-11). "Editor stable after attack by Komodo dragon / Surgeons reattach foot tendons of Chronicle's Bronstein in L.A". San Francisco Chronicle. http://www.sfgate.com/cgi-bin/article.cgi?f=/c/a/2001/06/11/MN204069.DTL. Retrieved 2008-03-23. 

Further reading

  • Attenborough, David (1957). Zoo Quest for a Dragon. London: Lutterworth Press. 
  • Auffenberg, Walter (1981). The Behavioral Ecology of the Komodo Monitor. Gainesville: University Presses of Florida. ISBN 0-8130-0621-X. 
  • Burden, W. Douglas (1927). Dragon Lizards of Komodo: An Expedition to the Lost World of the Dutch East Indies. Kessinger Publishing. ISBN 0-7661-6579-5. 
  • Eberhard, Jo; King, Dennis; Green, Brian; Knight, Frank; Keith Newgrain (1999). Monitors: The Biology of Varanid Lizards. Malabar, Fla: Krieger Publishing Company. ISBN 1-57524-112-9. 
  • Lutz, Richard L; Lutz, Judy Marie (1997). Komodo: The Living Dragon. Salem, Or: DiMI Press. ISBN 0-931625-27-0. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!