Overview

Brief Summary

Biology

With an almost insatiable appetite, the Nile monitor is renowned for eating just about anything it can overpower or find as carrion. Consequently, its diet includes everything from arthropods, amphibians and fish, to birds, small mammals and other reptiles (2) (3). Hunting strategies vary, but it is rare for the Nile monitor to shy away from a challenge, and will even team up to steal eggs from larger predators such as Nile crocodiles. Whilst one monitor provokes a female crocodile away from a nesting site, another will dig up the unguarded eggs (2). Propelled by its powerful tail, the Nile monitor is an excellent swimmer and reportedly can spend up to one hour submerged (2). Although largely aquatic, the mornings are often spent basking in the sun on rocky outcrops or sandy banks (3). On land, it walks with a sinuous swagger and will sometimes climb trees to bask, feed or sleep (2) (5). However, this species is more vulnerable on land and if threatened will normally do its best to avoid injury and flee to the safety of deep water. When escape is not an easy option, it will boldly defend itself, using its hefty tail, sharp teeth and powerful claws to injure or frighten away the aggressor (2) (3) (5). Following mating, which takes place at the end of the rainy season, the female lays up to 60 eggs (the largest clutch size of any lizard) in termite mounds or burrows (2) (3) (7). Under fairly constant temperature and humidity, the unattended eggs are incubated over a period of six to nine months before hatching (3). The brightly coloured hatchlings survive on a diet comprised almost entirely of insects and reach maturity after three to four years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The Nile monitor is not only Africa's largest lizard but also one of the continent's most voracious predators (3). Stout bodied and powerful, this formidable reptile has an elongated snake-like head, sharp claws, and a long, compressed tail which it uses to great effect when under threat (3) (4) (5). The tough, beady skin of the adult is greyish-brown with regular yellow spots arranged in distinctive bands down the head, body and tail. The colour patterning of juveniles is more vibrant, with dark black skin covered in bright yellow spots and blotches (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Large slender lizards, the largest in Egypt (and Africa). The maximum size recorded from Egypt is a female from Lake Nasser with a SVL of 800 mm (total length about 2,000 mm). Tail long (average tail/SVL ratio=1.4), laterally compressed, with a distinct dorsal crest. Nostril rounded, closer to snout tip than to eye; ear oval, tympanum moderately exposed. Dorsals granular, 136-183 around mid-body, each scale surrounded by rings of small granules; ventrals squarish, arranged in transverse rows. Iris brown. Dorsum dark olive-gray or blackish; back with an average of 7 (6-11) narrow light yellowish transverse bands on the back, and 13 (10-18) bands on the tail. Venter yellowish with gray markings. Pattern becomes obscure in old animals, while juveniles are black with yellow bands.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Varanus niloticus is found throughout most of sub-Saharan Africa. It is absent from the arid regions of the north and the southwest, but does reach Egypt along the Nile River.

Biogeographic Regions: ethiopian (Native )

  • Branch, B. 1998. Field Guide to Snakes and Other Reptiles of Southern Africa. Sanibel, Florida: Ralph Curtis Books.
  • Steel, R. 1996. Living Dragons. UK: Ralph Curtis-Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to many nations in Africa. Introduced (around 1990) and now established in Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

The upper-Egyptian Nile Valley south of Qena. Flower (1933) reports a single specimen just south of Cairo caught in 1911; however, the species appears to have disappeared from the lower Egyptian Nile Valley north of Qena. Between Qena and Aswan it is still found in fairly good numbers. In Lake Nasser it is widespread.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© BA Cultnat

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Distribution

Sub-Saharan Africa and Egypt.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Africa
Distribution: Republic of South Africa, Swaziland, Namibia, Botswana, Tanzania, Mozambique, Zimbabwe, Zambia, Angola, Malawi, Tanzania, Gaon, W/N/S Democratic Republic of the Congo (Zaire), Kenya, Uganda, Cameroon, Central African Republic, Ethiopia, Eritrea, Somalia, Dudan, Chad, Egypt, Liberia, Ivory Coast, Ghana, Togo, Benin, Burkina Faso, Niger, Nigeria, Mali, Mauritania, Senegal, Gambia (HÅKANSSON 1981)  
Type locality: “Indiis”
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The distribution of the Nile monitor extends through much of sub-Saharan Africa, from Senegal across to Somalia and down to northeast South Africa (2) (5) (6). It also occurs along the Nile up into southern Egypt (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Nile monitors may be Africa's largest lizards, though a former subspecies, now recognized as the species Varanus ornata, may be as big or bigger. Hatchlings are about 30 cm long and weigh about 26 g, but adults may grow to lengths of 2.4 m and have an impressively powerful physique. Sharp claws and strong muscular legs make it easy for them to climb trees. A deep, stoutly constructed skull, blunt crushing posterior teeth, and a bowed lower jaw make it easy for Nile monitors to eat hard-shelled prey such as mollusks. The tough skin is covered by bead-like scales. They have rounded nostrils which are located slightly nearer to the eye than to the snout. The toes are strong and moderately long. The tail of Nile monitors is compressed laterally with a dorsal keel and a very low double-toothed crest.

Adult Nile monitors are brownish or greenish-gray, with darker reticulation and yellowish spots or stripes on the back and limbs and yellowish-green spots on the head. Ventral surfaces are yellowish with blackish cross-bands. Juveniles are black, with the head bearing yellow cross-lines with black and yellow vertical bars on the lips. The neck features yellow lines and the back has a transverse series of yellow spots. The tail of juveniles has alternating black and yellow bars. This species exhibits no sexual dimorphism.

Range length: 2.4 (high) m.

Other Physical Features: heterothermic

Sexual Dimorphism: sexes alike

  • Cowles, R. 1928. The Life History of Varanus niloticus. Science: New Series, 67: 317-318.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

nile monitor size

120 to 160 centimeters

Creative Commons Attribution 3.0 (CC BY 3.0)

© en.wikipedia.org

Supplier: tubbymcentire

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Nile monitors inhabit a wide variety of habitats including woodland, dry savanna, scrub, evergreen thickets, swamps, and mangroves. Nile monitors are usually found near water, either temporary or permanent, but especially rivers, lakes, and pans. Their lifestyle is both terrestrial and aquatic and they are both superb climbers and swimmers which allows for great adaptability to different environments. Exposed, open areas are crucial habitat components as they require sufficient basking locations. This species is known to bask on open rooftops and streets. Young Nile monitors often lie on branches overhanging rivers or pools, and if disturbed will drop into the water. When alarmed and when water is not available, Nile monitors use their sharp claws and strong legs to climb trees up to a height of 5 to 6 meters. They are also known to flee down a hole or rocky crevice, or into a termite nest. Nile monitors live in burrows which they will excavate themselves or expand an existing one. A softer, sandy substrate is necessary to construct these burrows. This species has been documented at elevations from 0 to 1,600 m above sea level.

Range elevation: 0 to 1600 m.

Habitat Regions: temperate ; tropical ; terrestrial ; freshwater

Terrestrial Biomes: savanna or grassland ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools

Wetlands: swamp

Other Habitat Features: suburban

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: At Cape Coral, Florida, favorable occupied habitat exists along local canal systems.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits wetlands including rivers, canals, lakes and swamps, and the surrounding habitats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Given its colossal range, it is no surprise that the Nile monitor occurs in a wide variety of habitats, wherever there are permanent bodies of water (6). Although this excludes deserts, this species has been found in most other habitats including grassland, scrub, forests, mangroves, swamps, lakes and rivers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Nile monitors are stealthy hunters, concluding their predatory quests by pouncing with lightning speed on their prey. The teeth can administer a painful crushing bite, although this is likely to be lethal to only relatively small victims. While holding an adversary in its jaws, a Nile monitor can cause severe injuries with its claws. They often use a combination of jaws and powerful forelimbs to break the backs of their prey. They eat a variety of prey that includes frogs, toads (even poisonous ones of the genus Breviceps), rodents, fish, lizards, small turtles, birds and their eggs, beetles, orthopterans, crabs, caterpillars, spiders, millipedes, earthworms, and slugs. They have been known to rob crocodile nests for eggs. They may occasionally work in pairs to rob a crocodile nest, with one lizard distracting the guarding mother crocodile while the other races in to grab eggs. Even after hatching, newly emergent crocodiles are not safe. Hard-shelled mollusks are a conspicuous feature of Nile monitors' diets and a thickened skull, blunt crushing teeth, and bowed lower jaw make them well-equipped for breaking open thick shells. Land snails of the genus Achatina are Nile monitors' favorite prey.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; carrion ; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Nile monitors are both predators (on invertebrates and small vertebrates) and scavengers. Their persistent predation on crocodile nests may serve as a control on crocodile numbers.

Termite mounds make a perfect place for Nile monitors to lay their eggs, except during the dry season the hard clay makes it very difficult to burrow in. When the rain comes the females dig holes in the sides of termite mounds and lays their eggs. The termites quickly repair the gaping hole which protects the eggs during development.

Species Used as Host:

  • Termites (Eutermes trinervius)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nile monitors have few predators, but pythons prey on these lizards most often. Young Nile monitors make easy prey for a large python but even larger Nile monitors are at risk. A 4.5 m long African rock python has been reported to seize a 1.4 m long Nile monitor, and within half and hour had swallowed it head first. Crocodiles also take monitors on occasion. A defensive Nile monitor will arch its back and stand at full stretch on its legs, hissing as the body inflates and flicking the tail sideways. As a last resort a cornered Nile monitor will bite savagely and eject foul-smelling matter from the cloaca to deter attack or throw off a pursuer.

Known Predators:

  • African rock pythons (Python natalensis)
  • Crocodiles

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Varanus niloticus preys on:
Miopithecus talapoin

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Nile monitors use both visual and olfactory cues when sensing the environment. The long forked tongue supplies the vomero-nasal organ in the roof of the mouth. Their eyesight appears to be good. They perceive their environments through visual, tactile, auditory and chemical stimuli.

If cornered, these lizards will inflate the throat and hiss loudly, raise themselves up high, stiff-legged and lash with their tails to threaten the attacker.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

Diurnal, aquatic, and terrestrial lizard. Forages widely in and out of water, and feeds on a wide variety of food items, including fish, amphibians, lizards, snakes, young crocodiles, and carrion, and often forages in human waste tips. In the Nile Valley it forages widely among plantations and fields, and can be seen in very close proximity to humans, but is excessively cautious. Around Lake Nasser, tracks can be seen only within a hundred meters from the lake shore. Spends long periods basking, usually close to water, into which it plunges at the slightest sign of danger.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Nile monitor eggs may require 10 months of incubation, though eggs in captivity have hatched within as few as 129 days. Within the eggs the embryos are coiled with the snout being forced against the shell wall, ready to rupture the integument and emerge. Hatching takes from 15 minutes to 7 hours. Juveniles lack the crushing and bowed lower jaws of adults, but that most likely reflects the shift from an insectivorous to a molluscivorous diet. Maturity is reached in three to four years. Most wild populations exhibit steady, indeterminate growth throughout their lives, but some heavily exploited populations may undergo significant growth up until 30 months of age and then cease.

Development - Life Cycle: indeterminate growth

  • Buffrenil, V., G. Hemery. 2002. Variation in longevity, growth, and morphology in exploited Nile monitors (Varanus niloticus) from Sahelian Africa. Journal of Herpetology, 36 (3): 419 - 426.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Estimates vary, but the expected lifespan in captivity is reported at between 10 and 20 years.

Typical lifespan

Status: captivity:
10 to 20 years.

  • Bartlett, R., P. Bartlett. 1996. Monitors, Tegus, and Related Lizards. Hauppauge, New York: Barron's Educational Series, Inc..
  • Buffrenil, V., J. Castanet. 2000. Age Estimation by Skeletochronology in the Nile Monitor (Varanus niloticus), a Highly Exploited Species. Journal of Herpetology, 34: 414-424.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14.6 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Nile monitors are a polygynandrous species and will mate promiscuously. Males may reportedly fight each other in violent "wrestling matches," presumably due to competition for mating opportunities.

Mating System: polygynandrous (promiscuous)

Varanus niloticus breeds once annually, with the season starting in June and ending in October range-wide. Mating and egg laying usually follows the rainy season, which varies regionally. This season correlates with the development of the gonads. The testicles of males are enlarged from June until September while the females are being sought. Regression of the gonads subsequently occurs until January and then the cycle recommences.

After spring rains (August through September), the female excavates a hole in the ground or in an active termite nest and lays 20 to 60 eggs. This may take 2-3 days to complete. If she lays her eggs in a termite nest, the termites will repair the hole in their nest, and the monitor eggs develop inside. Eggs may take up to 1 year to hatch. The small young weigh an average 26 g upon hatching. After hatching, the young may need to wait for rain to soften the hard nest, or reportedly the mother monitor may return at the right time and open the nest to free the hatchlings. Once they have emerged, however, the baby Nile monitors are on their own.

Breeding interval: Varanus niloticus breeds once a year.

Breeding season: Varanus niloticus breeds from June until October.

Range number of offspring: 20 to 60.

Average number of offspring: 35.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization ; oviparous

Parental investment for Nile monitors does not extend far past initial egg fertilization and laying. The female will excavate a secure place to lay her clutch, either in the ground or in an active termite nest. The mother monitor may return to the clutch sometime after the young hatch and open the buried nest to free her hatchlings. Once the young have emerged, however, they are on their own.

Parental Investment: no parental involvement; female parental care ; pre-fertilization (Provisioning, Protecting: Female)

  • Branch, B. 1998. Field Guide to Snakes and Other Reptiles of Southern Africa. Sanibel, Florida: Ralph Curtis Books.
  • Cowles, R. 1928. The Life History of Varanus niloticus. Science: New Series, 67: 317-318.
  • Steel, R. 1996. Living Dragons. UK: Ralph Curtis-Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Varanus niloticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCCCGCTGATTATTCTCCACGAACCACAAAGATATCGGAACCTTATACTTAATCTTTGGGACCTGGGCCGGAATAGTTGGAACCGCCATAAGCCTCCTAATTCGAGCTGAACTAAGCCAACCCGGCACTATCCTCGGAAAT---GACCAAATCTATAACGTCATCGTAACCGCACACGCATTAGTCATAATTTTCTTCATAGTTATACCAATCATAATCGGCGGGTTCGGAAATTGATTAGTGCCATTAATAATTGGCGCCCCGGACATAGCCTTCCCACGAATAAATAACATAAGCTTTTGGCTCCTTCCTCCTTCCCTCCTTCTCCTTATAGCCTCAGCCTGGACAGATAGCGGCTCAGGAACAGGATGAACAGTATATCCCCCTCTTGCCGGAAATATCGCTCATGCCGGAGCATCAGTAGACTTAACAATCTTCTCACTGCATCTAGCAGGCATTTCATCAATTCTTGGGGCCATCAACTTTATCACCACATGCATTAACATAAAACCACCCACAATAACACAATACCATATACCCCTATTCGTCTGATCCGTCCTAATCACTGCAGTCCTCCTCCTCCTCTCTCTACCTGTCCTAGCAGCAGGAATTACTATACTCTTAACCGACCGAAATTTAAATACCTCCTTCTTCGACCCCGCAGGTGGGGGCGACCCCATTCTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATTCTACCGGGGTTCGGAATAATCTCTCACATTATCTCCTATTATTCAAGTAAAAAAGAACCCTTCGGATACATGGGAATAGTATGGGCCATAATATCCATCGGACTCCTAGGATTCCTAGTATGAGCCCATCACATATTTACAGTAGGCATAGACGTAGACACACGAGCCTACTTTACTTCTGCCACAATAATTATTGCCATCCCAACAGGAATTAAAGTATTCAGCTGGTTAGCAACCATACATGGCGGA---GTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Varanus niloticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

In 1975, some north African states replaced the Wild Animals Law created in 1963 with a new law that gives protection to crocodiles, pythons, and monitor lizards. Nile monitors are also listed under the Endangered Species Decree of 1985, which means that international trade of the species in prohibited. This species is listed under CITES, Appendix II.

US Federal List: no special status

CITES: appendix ii

  • Anadu, P. 1987. Progress in the Conservation of Nigeria's Wildlife. Biological Conservation, 41: 237-251.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Common in Lake Nasser, but declining in the Nile Valley below Aswan. While the erection of the High Dam created a vast new habitat for the species, where it is little molested, the dam has completely altered the ecosystem downstream, probably con­tributing to the decline and disappearance of the species from large parts of the Nile Valley. The species is collected in numbers for the pet trade, as well as for the leather industry. In Egypt it is Vulnerable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed on Appendix II of CITES (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Although the Nile monitor is exploited for its meat and skin, and to a lesser extent in the pet trade (8), it remains widespread and common (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

There are no specific conservation measures in place for the Nile monitor but it is listed on Appendix II of CITES which makes it an offence to trade Nile monitors without a permit (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Nile monitors have been known to acclimate to human towns, farms, and homesteads, and occasionally attack livestock such as chickens.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nile monitors are among the most exploited species of tetrapods in Africa where it is used for food and leather. In certain areas, Nile monitors are hunted to obtain fat from the reproductive organs. It is locally believed that when melted down, this fat is a cure for ear aches as well as a protection against lightning.

Nile monitor lizards consume crocodile eggs and may act as population control in some areas.

Nile monitors are occasionally kept as pets by reptile hobbyists, but these large and aggressive lizards are a poor choice as a pet except perhaps for very experienced keepers who can provide large enclosures.

Positive Impacts: food ; body parts are source of valuable material; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Nile monitors in Florida may eat the eggs and hatchlings of burrowing owls, a species of special concern, and the eggs of threatened gopher tortoises.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nile monitor

The Nile monitor (Varanus niloticus) is a large member of the monitor lizard family (Varanidae) found throughout much of Africa. Other common names include the African small-grain lizard,[2] water leguaan[3] or river leguaan (leguan, leguaan, and likkewaan mean monitor lizard in South African English, and can be used interchangeably).[4] Until 1997, the Nile monitor included the ornate monitor (V. ornatus) as a subspecies.[5]

Description[edit]

Nile monitors can grow to about 120 to 180 cm (3 ft 11 in to 5 ft 11 in) in length, with the largest specimens attaining 244 cm (8 ft 0 in).[6][7] In an average-sized specimen, the snout-to-vent length will be around 50 cm (1 ft 8 in).[8] In body mass, adults have been reported to vary widely, one study claiming only 0.8 to 1.7 kg (1.8 to 3.7 lb), others state weights ranging from 5.9 to 15 kg (13 to 33 lb) in big monitors. Variations may be due to age or environmental conditions.[9][10][11] Exceptionally large specimens may scale as much as 20 kg (44 lb), but this species weighs somewhat less on average than the bulkier Varanus albigularis, the only other African lizard to rival the Nile monitor in size.[12] They have muscular bodies, strong legs, and powerful jaws. Their teeth are sharp and pointed in juvenile animals and become blunt and peg-like in adults. They also possess sharp claws used for climbing, digging, defense, or tearing at their prey. Like all monitors, they have forked tongues, with highly developed olfactory properties. The Nile monitor has quite striking, but variable, skin patterns, as they are greyish-brown above with greenish-yellow barring on the tail and large, greenish-yellow rosette-like spots on their backs with a blackish tiny spot in the middle. Their throats and undersides are an ochre-yellow to yellow-cream with some faint barring often on their throats.[12]

Their nostrils are placed high on their snouts, indicating these animals are highly aquatic. They are also excellent climbers and quick runners on land. Nile monitors feed on fish, snails, frogs, crocodile eggs and young, snakes, birds, small mammals, large insects, and carrion.

Range[edit]

Nile monitors are native to Africa and the species is distributed throughout the entire central and southern regions of the continent, including Sudan and a portion of central Egypt along the Nile river. [13] They are not found in any of the desert regions of Africa, however, as they thrive around rivers. [14][15]

Invasive species[edit]

In Florida, established breeding populations of Nile monitors have been known to exist in different parts of the state since at least 1990. [16] The vast majority of the established breeding population of the species is in Lee County, Florida, particularly in the Cape Coral and surrounding regions, including the nearby barrier islands (Sanibel, Captiva, and North Captiva), Pine Island, Fort Myers, and Punta Rassa. Established populations also exist in adjacent Charlotte County, especially on Gasparilla Island.[15] Areas with a sizeable number of Nile monitor sightings in Florida include Palm Beach County just southwest of West Palm Beach along State Road 80.[17] In July 2008, a Nile monitor was spotted in Homestead, a small city southwest of Miami.[18] Other sightings have been reported near Hollywood, Naranja, and as far south as Key Largo in the Florida Keys.[17] The potential for the established population of Nile monitors in Lee, Charlotte, and other counties in Florida, to negatively impact indigenous crocodilians (American alligator Alligator mississippiensis and American crocodile Crocodylus acutus) is enormous given that they normally raid crocodile nests, eat eggs, and prey on small crocodiles in Africa. Anecdotal evidence indicates a high rate of disappearance of domestic pets and feral cats in Cape Coral. It also prey on other invasive species such as the Burmese Python egg nest[15]

In captivity[edit]

Nile monitors require experienced care as pets and are not recommended for beginners; nevertheless they are often found in the pet trade. Albino (amelanistic) specimens have been found and propagated in captivity.

References[edit]

  1. ^ IUCN Red List and search for Varanus niloticus
  2. ^ a b "Synonyms of Nile Monitor (Veranus nioloticus)". Encyclopedia of Life. Retrieved 15 December 2013. 
  3. ^ Varanus niloticus, The Reptile Database
  4. ^ Oxford Dictionaries. Oxford University Press http://www.oxforddictionaries.com/us/definition/english/leguan. Retrieved 17 December 2013.  Missing or empty |title= (help)
  5. ^ Böhme, W., & Ziegler, T. (1997). A taxonomic review of the Varanus (Polydaedalus) niloticus (Linnaeus, 1766) species complex. The Herpetological Journal 7: 155-162.
  6. ^ Nile Monitor Care Sheet
  7. ^ Enge, K. M., Krysko, K. L., Hankins, K. R., Campbell, T. S., & King, F. W. (2004). Status of the Nile monitor (Varanus niloticus) in southwestern Florida. Southeastern Naturalist, 3(4), 571-582.
  8. ^ "Varanus niloticus". Monitor Lizards – Captive Husbandry. Monitor-Lizards.net. Retrieved 15 December 2013. 
  9. ^ Condon, K. (1987). A kinematic analysis of mesokinesis in the Nile monitor (Varanus niloticus). Experimental biology, 47(2), 73.
  10. ^ Hirth & Latif 1979
  11. ^ "ANIMALS - Varanus niloticus". Dr. Giuseppe Mazza's Photomazza. Retrieved 2013-06-06. 
  12. ^ a b "Nile Monitors". L. Campbell's Herp Page. Retrieved 2013-06-06. 
  13. ^ (Schleich et al., 1996; Spawls et al., 2002).
  14. ^ Reptile Specialists (Nile monitor)
  15. ^ a b c "NAS - Invasive Species FactSheet: Varanus niloticus (Nile monitor)". Nonindenous Aquatic Species. Gainesville, FL: United States Geological Survey.  Unknown parameter |DUPLICATE_work= ignored (help)[dead link]
  16. ^ (Campbell, 2003; Enge et al. 2004).
  17. ^ a b Everglades CISMA
  18. ^ Hofmeyer, Erik (10 June 2008). "Homestead ARB home to diverse array of wildlife". Homestead Air Reserve Base News (Homestead Air Reserve Base). Retrieved 15 December 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!