Overview

Brief Summary

Biology

Little is known about the biology of this threatened species. It apparently lays clutches of two to six white, elongated eggs. Four-eyed turtles in captivity have eaten a diet of fruit, lettuce and fish (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The four-eyed turtle is a threatened (1), little-known reptile, named for the striking circular shapes on the top of the head that look like eyes (4). The carapace, or upper shell, of this species is brown speckled with darker flecks. The shell on the underside of the turtle, or plastron, is salmon pink, also with dark flecks and marks. The head is dark brown or black, with dark brown jaws and a pink or reddish chin. Three prominent light stripes run from the head, back along the neck. The backs of the dark brown forelimbs have a pinkish-red tinge (2), and webbed feet are suited to this turtle's aquatic lifestyle (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Continent: Asia
Distribution: SE China (incl. Hainan, Guangxi, Guizhou, Yunnan, Jiangxi), Vietnam, Laos  
Type locality: "Annam", Vietnam.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Apparently confined to northern Vietnam and southern China, including the island province of Hainan. The four-eyed turtle may also occur in the Lao People's Democratic Republic (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Semi-aquatic

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The four-eyed turtle inhabits streams and small brooks in woodland, at 100 to 400 metres above sea level (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sacalia quadriocellata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC6468-09|NC_011819|Sacalia quadriocellata| ACCCGATGATTTTTTTCTACAAACCATAAAGACATTGGCACCCTGTATTTGATTTTTGGGGCCTGAGCAGGTATAGTGGGCACAGCATTA---AGTTTATTAATCCGCGCAGAATTAAGCCAACCAGGAGCCCTTTTAGGGGAT---GATCAAATCTATAACGTCATCGTTACAGCCCATGCCTTCATCATAATTTTCTTCATGGTCATACCTGTTATAATCGGCGGCTTCGGAAATTGACTTGTACCCCTAATA---ATCGGAGCGCCAGATATAGCATTCCCGCGCATAAACAACATGAGCTTCTGACTTCTACCCCCATCACTACTTCTACTCCTAGCCTCATCAGGAATTGAAGCAGGCGCAGGCACAGGTTGAACGGTATACCCCCCATTAGCTGGAAACCTGGCCCACGCTGGCGCCTCTGTAGATTTA---ACTATTTTTTCCCTTCACCTAGCTGGTGTGTCATCAATTTTAGGGGCTATTAACTTTATCACTACAGCAATTAATATAAAACCCCCAGCTATATCACAATATCAAACACCTTTATTCGTATGGTCAGTACTCATCACAGCCGTCCTATTATTGCTTTCATTACCAGTACTTGCTGCA---GGTATCACTATACTACTCACAGACCGAAACTTAAATACAACCTTCTTTGACCCTTCAGGGGGAGGAGACCCAATTTTATACCAACACTTATTCTGATTCTTTGGCCATCCTGAAGTATACATCTTAATCTTGCCCGGATTTGGCATAATTTCACATGTTGTCACCTATTATGCTGGTAAAAAA---GAACCATTCGGATATATAGGAATAGTTTGAGCAATAATATCCATCGGGTTCCTAGGCTTTATCGTATGAGCCCACCATATGTTTACCGTTGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sacalia quadriocellata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A1d+2d

Version
2.3

Year Assessed
2000

Assessor/s
Asian Turtle Trade Working Group

Reviewer/s
Buhlmann, K., Rhodin, A. & van Dijk, P.P. (Tortoise & Freshwater Turtle Red List Authority)

Contributor/s

Justification
There are modest to small populations in Lao and Viet Nam, where it is not under great threat, but the main population in China is certainly Endangered.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1), and listed on Appendix III of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Like many other freshwater turtles, the largely uncontrolled and devastating trade for food and traditional medicine in many parts of Asia poses the greatest threat to the four-eyed turtle (1) (6). The fairly small populations in Lao PDR and Vietnam are not considered as threatened as the main population in China, where it is at risk of extinction (1), probably due to the fact that China is the major consumer of freshwater turtles (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix III (China).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Despite many turtle species being protected by a listing on the Convention on International Trade in Endangered Species (CITES) and China's Wild Animals Protection Law, freshwater turtles are still found in restaurants and food markets. Raised conservation awareness and more effective law enforcement is required if the four-eyed turtle, and other freshwater turtles, are to survive (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Four-eyed turtle

The Four-eyed turtle[1] (Sacalia quadriocellata) is a reptile of the order Testudines. Its name referns to two bright yellow or green spots that occur on the back of its head that can look like another pair of eyes. This species of turtle occurs in southern China and Hainan, in the Annamite Mountains and northeastern region of Laos, and in the mountains of northern and central Vietnam.[2]

A male of this species has successfully produced hybrids with the Chinese Pond Turtle in captivity. Given that the "four-eye" pattern is inherited by these hybrids, it seems well possible that the mysterious Chinese False-eyed Turtle is actually based on a hybrid specimen.[3]

Contents

Description

The four-eyed turtle can grow to be 15 centimeters long. Its carapace typically ranges in color from a yellowish-tan to a deep chocolate-brown and all turtles have a distinct pattern of lines. The turtle's head is often colorful with yellow or green eyes, yellow stripes, and a pink or red throat. Two (sometimes four) eye-like ocelli occur on the back of the head, hence the turtle's name.[4][verification needed][5]

Ecology

Four-eyed turtles occur in freshwater streams, brooks, and ponds in woodland, often mountainous habitats. As a result of their rugged surroundings, they have evolved to become adept climbers.

While their dietary preferences have not been studied in detail, it is known that they do eat a wide variety of animals and plants including crickets, worms, snails, trout chow, aquatic plants, greens and lettuces, and certain fruits.[2]

Status and conservation

Though considered to be endangered everywhere it exists, according to the IUCN, the modest populations of four-eyed turtles in Laos and Vietnam are not in any great or present danger. China is where the species is most threatened.[2]

A main factor in the decline of the four-eyed turtle is trade and demand for their shells.[citation needed] Therefore, species recovery programs are needed to ensure the future of the species. There is currently an extensive communication between zoo and conservation personnel in Vietnam whose goal is to coordinate recovery programs. The recovery programs will include legal protection for the turtles which will affect turtle trading.[citation needed]

Large quantities of turtle shell are used as an ingredient in Traditional Chinese Medicine (TCM). For instance, Taiwan confirmed that 940 tons of hard shelled turtle bone and 200 tons of soft shell turtle bones were imported between 1992 and 1998. The plastron - the belly shell - is used in TCM prescriptions. Some TCM scientists argue that there is no difference between plastron and carapace (back shell) bone. So, if both plastron and carapace bone are utilized, the demand of TCM for freshwater turtles, including four-eyed turtles, could decrease by 50%[verification needed].[6][7] Current TCM research also suggests that there is no pharmaceutical difference in the effects of bone from animals produced on farms and animals captured in nature. As a result, farm production of turtle bone for TCM is likely to increase. In addition, TCM research could help find alternatives to turtle bone such as herbs.

Conservation efforts

The Asian Turtle Conservation Network has helped publicize turtle conservation all throughout Asia.[8] The ATCN has a regularly updated website with up-to-date news that helps spotlight the status of endangered turtles throughout Asia.

References

  1. ^ Sometimes confused with a related and similar species, Beal's four-eyed turtle
  2. ^ a b c "Sacalia quadriocellata". Asian Turtle Conservation Network. http://www.asianturtlenetwork.org/field_guide/sacalia_quadriocellata.htm. Retrieved 2007-05-08. 
  3. ^ Parham et al. (2001), Buskirk et al. (2005).
  4. ^ "Sacalia bealei : Four-eyed Turtle". The Asian Turtle Consortium. http://www.asianturtle.org/htm/species_Sacalia_bealei.html. Retrieved 2007-05-15. 
  5. ^ "Chinese Four-Eyed Turtles, genus Sacalia". Hopson, Mary. http://www.turtlepuddle.org/exotics/sacalia.html. Retrieved 2007-05-09. 
  6. ^ "Conclusions from the Workshop on Trade in Tortoises and Freshwater Turtles in Asia". Asian Turtle Trade Working Group. http://nytts.org/asia/trade-ws.htm. Retrieved 2007-05-19. 
  7. ^ Or even more, since the carapace is larger than the plastron.
  8. ^ "Asian Turtle Conservation Network". http://www.asianturtlenetwork.org/. Retrieved 2007-05-19. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!