Overview

Brief Summary

New York State Invasive Species Information

Introduction

The hemlock woolly adelgid (HWA, Adelges tsugae) is an aphid-like, invasive insect that poses a serious threat to forest and ornamental hemlock trees (Tsuga spp.) in eastern North America. HWA are most easily recognized by the white “woolly” masses of wax, about half the size of a cotton swab, produced by females in late winter. These fuzzy white masses are readily visible at the base of hemlock needles attached to twigs and persist throughout the year, even long after the adults are dead.

Origin and Spread

Hemlock woolly adelgid is native to Japan and possibly China where it is considered a common inhabitant of both forest and ornamental hemlock and spruce trees. It rarely achieves pest outbreak densities or inflicts significant damage to host trees in its native Asian habitat because natural enemies and host plant resistance help keep HWA populations in check.

Hemlock woolly adelgid was first detected on the east coast of North America in Richmond, Virginia, in the mid-1950s (Souto et al. 1995). Since its likely accidental introduction from southern Japan (Havill et al. 2006), HWA has spread to 18 eastern states from Georgia to Maine, devastating populations of native eastern (Tsuga canadensis) and Carolina (T. caroliniana) hemlock. HWA now covers nearly half the range of native hemlocks and appears to be spreading about 10 miles a year. It has reached its southern limit, but continues to expand its range to the west and north.

HWA was first detected in New York State in the early 1980s (Souto et al. 1995). Outbreaks have expanded from initial infestations on Long Island and in the Hudson Valley to the Rochester area, the Catskill Mountains, and recently into the Finger Lakes region.

HWA was first detected on the west coast of North America in British Columbia in the 1920s, and now also has a range from northern California to southeastern Alaska. There, it occurs on both mountain hemlock (Tsuga mertensiana) and western hemlock (T. heterophylla) trees. However, HWA does not cause extensive mortality or damage on West Coast hemlocks. Recent comparative genetic analyses suggest that populations in the Pacific Northwest may actually be endemic to that region or originated from very early introductions.

Biology

The hemlock woolly adelgid has a complex life cycle, involving two different tree host species as well as asexual and sexual life stages. On eastern hemlock, HWA produces two generations a year, an overwintering generation (sistens) and a spring generation (progrediens); these two generations overlap in the spring. The progrediens has two forms, a wingless form that remains on the hemlock and a winged form (sexuparae) that flies in search of a suitable host spruce tree upon which to start a sexual reproductive cycle (McClure 1995). In New York, there are no suitable spruce, thus the winged HWA are not successful. Each generation has six stages of development: egg, four juvenile (nymph) stages, and the adult.

Overwintering adult females are black, oval, and soft-bodied (approximately 2mm long). They are usually concealed under the white woolly masses of wax (ovisacs) they secrete from special glands on their back-side. From March through May, these females lay 50 to 300 eggs in the woolly masses. The eggs are brownish-orange and very small (0.25mm long by 0.15mm wide). Depending on spring temperatures, eggs hatch from April – June.

Newly hatched nymphs – also known as crawlers – are reddish-brown with a small white fringe near the front (less than 0.5mm long). Crawlers search for suitable sites to settle, usually at the base of the hemlock needles, where they begin to feed and will remain attached to the tree with their specialized sucking mouthparts for the rest of their lives. Crawlers, an important dispersal phase of HWA on hemlocks, can be spread by wind, on the feet of birds, or in the fur of small mammals (McClure 1990). Once settled, these HWA crawlers quickly develop through the four nymph life stages, and mature in June.

Some of the adults of the spring generation (progrediens) are wingless and remain on the hemlock tree, feeding and producing eggs protected by woolly masses just like the overwintering generation, but during June-July. Their offspring hatch into crawlers, quickly settle onto hemlock branches, begin to feed and then enter a dormant period for several months until late October when feeding and development resumes. These nymphs become the next overwintering generation (sistens). The other portion of spring adults has wings and leaves the hemlock trees in June in search of spruce trees to complete the sexual phase of HWA reproduction. However, in North America, no spruce species (Picea spp.) are suitable hosts and any offspring produced die within a few days of feeding. Thus, the winged adult form can be a significant source for HWA population reduction. This is particularly important considering the number of winged adults produced in the spring generation increases with the density of overwintering adelgids, likely a result of changes in nutritional quality in the hemlock host tree.

Impacts

The hemlock woolly adelgid feeds deep within plant tissues by inserting its long sucking mouthparts (stylets) into the underside of the base of hemlock tree needles. It taps directly into the tree’s food storage cells, not the sap. The tree responds by walling off the wound created by the insertion of the stylets. This disrupts the flow of nutrients to the needles and eventually leads to the death of the needles and twigs. Needles will dry out and lose color, turning gray and eventually dropping from the tree. Terminal buds will also die resulting in little to no new shoot growth. Dieback of major limbs can occur within two years and generally progresses from the bottom of the tree upward (McClure et al 2001).

The hemlock woolly adelgid has an impressive reproductive potential: consider that one female in the winter generation produces an average of 200 eggs which in turn mature and each female of this adult spring generation produces on average another 200 eggs each. That’s 40,000 eggs in one year, starting from one individual female! Thus, HWA populations can grow rapidly in a relatively short period of time. Heavy HWA infestations, particularly in the southern Appalachian Mountains, can kill hemlock trees in as little as four years, with older trees dying more quickly. However, for reasons still under investigation, some infested trees in parts of New England survive for 10 years or more.

HWA infestation resulting in thinning of hemlock Decline and mortality in infested hemlock in North Carolina Eastern hemlocks play a unique ecological role in eastern forests. Long-lived and shade tolerant, hemlocks may grow in single-species stands or in combination with deciduous hardwood species. They are frequently found growing on exposed slopes as well as protected gorges and stream bottoms. Eastern hemlocks create a cool, damp and shaded microclimate that supports unique terrestrial plant communities, maintains cool stream water temperatures for fish and stream salamanders, and provides important winter habitat structure and food resources for wildlife. Research, particularly in the hard-hit southern hemlock forests, has indicated that declines in hemlock from HWA can result in losses of unique plant and animal assemblages and drastic changes to ecosystem processes (Ellison et al. 2005).

Climate change, particularly warmer summer temperatures, will affect the suitability of habitat for eastern hemlock in the Northeast. Perhaps more troublesome are projected increases in overwintering temperatures that may promote the range expansion of HWA into more northern hemlock forests, areas previously considered unsuitable for HWA survival (Paradis et al. 2008).

Detection

Detecting new HWA infestations at the leading edge of its range is critically important for slowing the spread of HWA. Unfortunately, HWA is difficult to detect at low population levels. The first signs of HWA are the presence of the white, woolly ovisacs on the underside of twigs, most often on the newest growth. This white, waxy wool is most easy to observe with the naked eye or through binoculars January through June. Other signs of infestation include graying and dropped needles and limb dieback.

Light infestation of hemlock woolly adelgid Heavy infestation of hemlock woolly adelgid Winter is the optimal time to detect HWA, as the ovisacs are most apparent and the leaves from adjacent deciduous trees that could interfere with observations are absent. An inexperienced observer may confuse several look-alikes with HWA. Spider sacs may look superficially similar but are constructed of much stronger fibers and are usually not closely pressed to hemlock twigs. Spittlebugs, never found in the winter, produce watery, white foam, not wooly and waxy fibers. Scale insects are common, but are found directly on the hemlock needles, not the twigs. Pine pitch and bird droppings may also confuse an untrained observer. For more information about examining hemlock trees and surveying hemlock stands, please see Whitmore (2009) "Early Detection of the Hemlock Woolly Adelgid (Adelges tsugae) in Small Northeastern Hemlock (Tsuga canadensis) Woodlots"

Management

Currently, the two approaches for managing HWA infestations are chemical insecticides and the use of natural enemy predator species as biological control. Infested hemlock trees can be protected individually with chemical, systemic insecticides. These insecticides, typically applied as a soil drench or an injection into the soil below the organic layer or as a basal brak spray, are incorporated by sap flow into the tree’s tissues and can provide multiple years of protection from a single treatment. However, the costs associated with application, environmental safety concerns about applying insecticides near water resources, and the tremendous reproductive potential of HWA makes this approach less feasible on a broad scale in natural areas. For insecticide guidlines for New York State see Cornell University's Crop and Pest Management Guidelines http://ipmguidelines.org/. And, consult a certified pesticide applicator.

To manage HWA at the landscape scale, researchers have been investigating the use of biological control agents. Over the last 10 years, scientists have evaluated the effectiveness of several HWA predators from Japan and the Pacific Northwest including the beetles, Sasajiscymnus tsugae, Scymnus spp., and Laricobius nigrinus as well as fungal pathogens. Some promising evidence has emerged, but further study is needed to test the effectiveness of biological control at larger geographical scales and over the long-term (Cheah et al. 2004).

Homeowners would be wise to take an integrated management approach for HWA-infested hemlock trees on their property. In lieu of systemic insecticides, spraying hemlock foliage with properly labeled horticultural oils and insecticidal soaps may be effective when trees are small enough to be saturated in order to ensure that the insecticide comes in contact with the adelgid. Owners can reduce hemlock tree stress by watering during drought periods and pruning dead and dying limbs and branches. Avoid the use of nitrogen fertilizers on infested hemlocks as it will actually enhance HWA survival and reproduction. Take care moving plants, logs, and mulch from infested to uninfested areas, particularly when HWA eggs and crawlers are present (March – June). Actions such as moving bird feeders away from hemlocks and removing isolated infested trees from a woodlot may also help prevent further infestations. Please read NC State Extension's Recommendations for Hemlock Woolly Adelgid Control in the Landscape.

Woodlot owners should consult Orwig & Kittredge (2005) for available silvicultural options. Remember, when using a pesticide, first consult your local CCE office or State pesticide guide to identify insecticides that are registered for use in your state and the proper timing for chemical application.

  • Cheah, C., M. E. Montgomery, S. Salom, B. L. Parker, S. Costa, and M. Skinner, 2004. Biological control of hemlock woolly adelgid. USDA For. Serv. FHTET-2004-04, Reardon, R. and B. Onken (Tech. Coordinators), 22pp.
  • Ellison, A. M., M. S. Bank, B. D. Clinton, E. A. Colburn, K. Elliott, C. R. Ford, D. R. Foster, B. D. Kloeppel, J. D. Knoepp, G. M. Lovett, J. Mohan, D. A. Orwig, N. L. Rodenhouse, W. V. Sobczak, K. A. Stinson, J. K. Stone, C. M. Swan, J. Thompson, B. V. Holle, and J. R. Webster. 2005. Loss of foundation species: consequences for the structure and dynamics of forested ecosystems. Frontiers in Ecology and the Environment 3:479-486.
  • Havill, N. P., M. E. Montgomery, G. Yu, S. Shiyake, and A. Caccone. 2006. Mitochondrial DNA from Hemlock Woolly Adelgid (Hemiptera: Adelgidae) Suggests cryptic speciation and pinpoints the source of the introduction to eastern North America. Annals of the Entomological Society of America 99:195-203.
  • McClure, M.S. 1990. Role of wind, birds, deer, and humans in the dispersal of hemlock woolly adelgid (Homoptera: Adelgidae). Environmental Entomology, 19(1) 36-43.
  • McClure, M.S. 1995. Biology of Adelges tsugae and its potential for spread in the Northeastern United States. Pages 16-25 in Proceedings of the First Hemlock Woolly Adelgid Review. USDA Forest Service Forest Health Technology Enterprise Team, FHTET 96-10. Charlottesville, VA.
  • McClure, M.S., S.M. Salom, and K.S. Shields. 2001. Hemlock woolly adelgid. FHTET-2001-03. Morgantown, WV: U.S. Department of Agriculture, Forest Service, Forest Health Technology Enterprise Team; 14 p.
  • Orwig, D. A. and D. Kittredge. 2005. Silvicultural options for managing hemlock forests threatened by hemlock woolly adelgid. Harvard Forest Fact Sheet.
  • Paradis, A., J. Elkinton, K. Hayhoe, and J. Buonaccorsi. 2008. Role of winter temperature and climate change on the survival and future range expansion of the hemlock woolly adelgid (Adelges tsugae) in eastern North America. Mitigation and Adaptation Strategies for Global Change 13:541-554.
  • Souto, D., T. Luther, and B. Chianese. 1995. Past and current status of HWA in eastern and Carolina hemlock stands. Pages 9-15 in Proceedings of the First Hemlock Woolly Adelgid Review. USDA Forest Service Forest Health Technology Enterprise Team, FHTET 96-10. Charlottesville, VA. source or sink in the Great Lakes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The New York Invasive Species Clearinghouse, Cornell University Cooperative Extension

Supplier: Tracy Barbaro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adelges tsugae, or the the Hemlock Woolley Adelgid (also known also as HWA) is an aphid-like insect introduced to Eastern North America from China and Japan in the 1920s. Since then it has spread to become a serious pest causing widespread death and decline of the Eastern (Tsunga canadensis) and Carolina (T. caroliniana) hemlocks in the Eastern United States. Because of HWA infestations, the national park service announces: “The impact of widespread loss of hemlock could trigger changes [as] significant as those that followed the demise of the American Chestnut in the 1930s and 40s.”

Few options to manage HWA in forests exist at this time, although chemical and cultural management practices and biological controls are being developed. There are few natural predators of the HWA in North America, and these have little to no effect on populations of this pest. Hybridization of Eastern Hemlock species with Asian and western species of hemlocks (T. heterophylla and T. mertensiana) may improve resistance of eastern hemlocks to HWA. Research is also being carried out to evaluate the potential for biological control of American HWA populations by importing two very effective asian predators; these are an oribatid mite (Diapterobates humeralis) and a ladybird beetle (Pseudoscymnus tsugae).

HWA can damage trees very quickly, and usually kills the tree within three to five years of infesting it. Using piercing and sucking mouthparts, the Hemlock Wooley Adgeid feeds on plant juices at the base of the needles, and while doing so, also injects toxic saliva that causes the death of the needles. HWA is can be recognized by the white protective wax it secretes as protection, which looks like a woolly ball at the base of hemlock needles. HWA is frequently dispersed by birds, animals and wind, as well as by hitch-hiking to new locations on contaminated branches.

(McClure, 2007; National Park Service 2011; Wikipedia 2011; United States Department of Agriculture, 2011)


Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Adelges tsugae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 119 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTCATATTTGGTATATGATCAGGAATAATTGGATCATCATTAAGAATAATCATTCGATTAGAATTAAGACAAATCAATTCAATTATTTATAATAACCAATTATATAATGTAATTATTACAATCCATGCTTTCATTATAATTTTCTTTATAACTATACCAATTGTAATTGGAGGATTTGGAAATTGATTAATTCCAATAATAATAAGAACACCTGATATATCATTTCCACGACTAAATAACATTAGATTTTGACTCCTCCCGCCTTCTTTAATAATAATAATATTTAGATTTATAATCAATAATGGAACAGGAACAGGATGAACAATTTATCCACCATTATCAAATATTATTTCACATAATAATATTTCAGTAGATTTAACTATTTTTTCTTTACATATAGCAGGAATCTCATCAATCTTAGGAGCAATTAACTTTATTTGTACTATCCTAAATATAATACCCAATAATATAAAATTATCCCAAATTCCATTATTTCCATGATCAATTCTAATTACTGCAATTTTATTAATCTTATCCTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATCTTAATACATCTTTCTTTGACCCCTCTGGAGGAGGTGACCCAATCTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelges tsugae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 119
Specimens with Barcodes: 160
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hemlock woolly adelgid

Hemlock woolly adelgid (Adelges tsugae), or HWA, is member of the Sternorrhyncha suborder of the Order Hemiptera and native to East Asia. It feeds by sucking sap from hemlock and spruce trees (Tsuga spp.; Picea spp.). In eastern North America, it is a destructive pest that gravely threatens the eastern hemlock (Tsuga canadensis) and the Carolina hemlock (Tsuga caroliniana). Though the range of Eastern Hemlock extends north of the current range of the adelgid, it could spread to infect these northern areas as well. Accidentally introduced to North America from Japan, HWA was first found in the eastern United States near Richmond, VA in the early 1950s. The pest has now been established in eleven eastern states from Georgia[1] to Massachusetts, causing widespread mortality of hemlock trees. As of 2007, 50% of the geographic range of eastern hemlock has been impacted by HWA.[2]

Characteristics[edit]

The presence of HWA can be identified by its egg sacs, which resemble small tufts of cotton clinging to the underside of hemlock branches. Hemlocks stricken by HWA frequently become grayish-green rather than the dark green of healthy hemlocks. In North America, the hemlock woolly adelgid asexually reproduces and can have two generations per year. In its native Asian habitat is a third winged generation called Sexupera; this generation's reproduction requires a species of spruce that is not found in the Eastern United States and therefore dies there. Between 100 and 300 eggs are laid in the woolly egg sacs beneath the branches. Larvae emerge in spring and can spread on their own or with the assistance of wind, birds and/or mammals. In the nymph stage, the adelgid is immobile and settles on a single tree.[3][4]

The hemlock woolly adelgid feeds on the phloem sap of tender hemlock shoots. It may also inject a toxin while feeding. The resulting desiccation causes the tree to lose needles and not produce new growth. In the northern portion of the hemlock's range, death typically occurs four to ten years after infestation. Trees that survive the direct effects of the infection are usually weakened and may die from secondary causes.[5]

Control methods[edit]

Forest level[edit]

The current leading biological control method of hemlock woolly adelgid is Pseudoscymnus tsugae. P. tsugae is a black lady beetle that is relatively host specific, feeding only on hemlock woolly adelgid, balsam woolly adelgid, and pine bark adelgid. This beetle was discovered feeding on hemlock woolly adelgid in its natural homeland of Japan in 1992. Since 1995 the DCNR's Bureau of Forestry has released more than 100,000 adult beetles in infested hemlock forests throughout Connecticut, New Jersey and Virginia by to evaluate P. tsugae as a biological control agent.[6] Experiments conducted in Connecticut and Virginia from 1995 through 1997 found that releasing adult P. tsugae beetles into an infested hemlock forest reduced adelgid densities by 47-88% within 5 months. The life cycle of P. tsugae is closely synchronized with the life cycle of the hemlock woolly adelgid. Both lay eggs in the spring and hatching occurs nearly simultaneously. When hatched, P. tsugae larvae are highly mobile and feed on hemlock woolly adelgid eggs and larvae. Each larva can consume about 500 adelgid eggs or from 50-100 immature adelgids.[7]

Laricobius nigrinus is a beetle native to western North America and feeds only on woolly adelgids. L. nigrinus adults lay eggs on wintering hemlock woolly adelgid larvae. L. nigrinus larvae emerge and feed on hemlock woolly adelgid. L. nigrinus beetles can only complete their development by feasting on hemlock woolly adelgid.[6]

Also under study is Laricobius osakensis from Japan, a relative of L. nigrinus. They have shown promise in field trials.

Treating individual trees[edit]

Insecticidal soap/horticultural oil is the environmentally safest chemical control method for hemlock woolly adelgid. These insecticides are non-toxic. They are applied to the foliage and kill the insect by smothering it as the spray dries. Most trees will need to be treated on a yearly basis.[8]

Tree foliage insecticides are applied to the foliage of the tree and will persist on the foliage and continue killing hemlock woolly adelgid for up to two to three years after application. However, these materials are more toxic than insecticidal soaps/horticultural oils.[8]

Soil drenches/Soil injections/bark sprays are used in larger trees that cannot be completely sprayed with insecticidal soaps or foliage insecticides. Tree roots absorb and transport the product into the foliage and kill hemlock woolly adelgid. Soil drenches must be applied when there is adequate soil moisture for the tree roots to absorb the product. These products should not be used in areas that are in close proximity to bodies of water.[8]

Trunk injections are used for large trees that are near water or where soils are too rocky for soil injections or drenches. The chemical is injected directly into the tree and transported to the twigs and needles where the hemlock woolly adelgids are feeding. Adequate soil moisture is also necessary for the tree to take up these products.[8]

Significance[edit]

Hemlock is a vital component of the New England forest system, and is the third most prevalent tree in Vermont. Providing protection from erosion along stream banks, food for deer and wildlife, and shelter for deer in the winter, hemlock is also valued both as an ornamental and as an important source of lumber. Unlike the balsam woolly adelgid that attacked only mature balsam fir, HWA infests hemlocks of all ages. Where hemlock occurs in pure stands in that region, the most commonly observed tree species to succeed it is black (sweet) birch. Whereas in the southern extreme of its range, hemlock typically occurs not in pure stands but in linear riparian areas and other moist sites. Succession in these areas is affected by the presence of Rhododendron maximum which often coexists with hemlock, and because of a combination of influences restricts regeneration to shade and otherwise understory-tolerant plant species. Major changes in ecosystem structure and function, including hydrologic processes, are expected with the loss of hemlock.

A 2009 study conducted by scientists with the U.S. Forest Service Southern Research Station suggests the hemlock woolly adelgid is killing hemlock trees faster than expected in the southern Appalachians, and rapidly altering the carbon cycle of these forests. According to Science Daily, the pest could kill most of the region's hemlock trees within the next decade. According to the study, researchers found "hemlock woolly adelgid infestation is rapidly impacting the carbon cycle in [hemlock] tree stands", and "adelgid-infested hemlock trees in the South are declining much faster than the reported 9-year decline of some infested hemlock trees in the Northeast."[9] In fact, as of 2007 the rate was recorded as 15.6 km/year south of Pennsylvania and 8.13 km/year (or less) in the northern section of the HWA’s range.[10]

References[edit]

  1. ^ "Helping Hemlocks". Yahoo.com. 
  2. ^ Kok, Loke T.; Salom, Scott M., et al. "Biological Control of the Hemlock Woolly Adelgid". Virginia Tech College of Agriculture and Life Sciences, Department of Entomology. 
  3. ^ "Hemlock Wooly Adelgid". Pennsylvania Department of Conservation and Natural Resources. Retrieved 2 January 2009. 
  4. ^ "Other Exotic Forest Threats - Hemlock Woolly Adelgid". Wisconsin Department of Natural Resources. 
  5. ^ McClure, Mark S. "Hemlock Wooly Adelgid Greenshare Factsheet". University of Rhode Island, University of Maryland Cooperative Extension. 
  6. ^ a b "Forest Health Fact Sheet". Pennsylvania Department of Conservation and Natural Resources. Retrieved 2014-02-16. 
  7. ^ Shelton, Anthony. "A Guide to Natural Enemies in North America". Ph.D. Professor of Entomology, Cornell University. Cornell University. Retrieved 2014-02-16. 
  8. ^ a b c d Sidebottom, Ph.D., Jill. "Recommendations for Hemlock Woolly Adelgid Control in the Landscape". North Carolina Cooperative Extension Service. Retrieved 2014-02-16. 
  9. ^ "Science Daily: Hemlock Trees Dying Rapidly, Affecting Forest Carbon Cycle". University of Toronto. 
  10. ^ Rentch, J.; Fajvan, M.A.; Evans, R.A.; Onken, B. (2008). "Using dendrochronology to model hemlock woolly adelgid effects on eastern hemlock growth and vulnerability". Biological Invasions 11 (3): 551–563. doi:10.1007/s10530-008-9270-x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!