Overview

Brief Summary

Adelges cooleyi, the Cooley spruce gall adelgid, is a species of aphid-like insects in the order Homoptera, native to forests in the rocky and cascade mountain ranges of the west coast of North America. These insects have a complex life cycle that takes two years and six generations to complete, and involves two host plants. In the fall, nymphs settle to overwinter on their primary host, Picea (spruce trees). They attack Cooley spruce, and also blue spruce to a lesser degree. They lay eggs in the spring, which hatch into nymphs, which, as they start eating at the base of the needles, inject saliva that induces the spruce to form a pinkish colored pineapple-shaped gall. This gall houses them until they emerge as winged (in the case of the females) adults. These then migrate to the adalgid’s secondary host species, Douglas fir (Pseudotsuga), where they eat the needles but do not form a gall structure. The damage done to spruce is mostly aesthetic; it causes branches to misform and causes necrosis where the galls form. Large infestations on Douglas fir can cause foliage discoloration and loss of needles, which is damaging in Christmas tree plantations as well as nursery stock.

(Wikipedia 2011; Ahern et al, 2009; Gumming, 1959)

  • Ahern RG, Hawthorne DJ, Raupp MJ. 2009. Phylogeography of a specialist insect, Adelges cooleyi: historical and contemporary processes shape the distribution of population genetic variation. Mol Ecol. 18(2):343-56.
  • Gumming, M.E.P. 1959. The Biology of Adelges cooleyi (Gill.) (Homoptera: Phylloxeridae). The Canadian Entomologist, 91:(10) 601-617, 10.4039/Ent91601-10
  • Wikipedia, The Free Encyclopedia. 5 July, 2011. “Gall adelgid”. Retrieved September 26, 2011 from http://en.wikipedia.org/w/index.php?title=Gall_adelgid&oldid=437843863
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Syntype for Adelges cooleyi
Catalog Number: USNM USNM396962
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female; Adult
Preparation: Slide
Collector(s): C. Gillette
Locality: Fort Collins, Larimer, Colorado, USA
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Adelges cooleyi
Catalog Number: USNM USNM396961
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female; Adult
Preparation: Slide
Collector(s): C. Gillette
Locality: Fort Collins, Larimer, Colorado, USA
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Adelges cooleyi
Catalog Number: USNM USNM396960
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female; Adult
Preparation: Slide
Collector(s): C. Gillette
Locality: Fort Collins, Larimer, Colorado, USA
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Adelges cooleyi
Catalog Number: USNM USNM396959
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female; Adult
Preparation: Slide
Collector(s): C. Gillette
Locality: Fort Collins, Larimer, Colorado, USA
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Adelges cooleyi
Catalog Number: USNM USNM396958
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female; Adult
Preparation: Slide
Collector(s): C. Gillette
Locality: Fort Collins, Larimer, Colorado, USA
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Foodplant / sap sucker
hypophyllous Adelges cooleyi sucks sap of live branch of Pseudotsuga menziesii
Remarks: season: summer

Foodplant / gall
hypophyllous Adelges cooleyi causes gall of live, yellowing shoot tip of Picea sitchensis

Animal / honeydew feeder
Cladosporium feeds on honeydew Adelges cooleyi

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Adelges cooleyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 318 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATATTTGGAATATGATCAGGAATAATTGGTTCTTCTTTAAGAATTATTATCCGACTTGAATTAAGACAAATTAATTCTATCATTAATAACAACCAATTATATAATGTTATTATTACAATTCATGCATTTATTATAATTTTTTTTATAACAATACCTATTGTAATTGGAGGATTTGGAAATTGATTAATTCCTATAATAATAGGATCCCCTGATATATCATTTCCACGATTAAATAATATTAGATTTTGATTATTACCTCCTTCATTAATAATAATAATATTTAGATTAATAATTAATAACGGAACCGGTACAGGATGAACAATTTACCCCCCCCTATCAAACAACATCTCACATAATAATATTTCAGTTGACTTAACTATCTTTTCATTACATATAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTTGTACAATTCTTAATATAATACCAAATAATATAAAATTAAATCAAATCCCACTATTTCCATGATCAATTTTAATTACCGCAATTTTATTAATTTTATCTTTACCAGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATCTAAATACATCTTTTTTTGACCCTTCAGGAGGAGGAGATCCAATCTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Adelges cooleyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 245
Specimens with Barcodes: 350
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gall adelgid

Gall adelgid refers to an adelgid species, Adelges cooleyi that produces galls in spruce trees. They infect the new buds of native spruce trees in the foothills of the Rocky Mountains in the spring. They also attack blue spruce to a lesser degree. The insects complete two generations within the year. They require two different trees for its life cycle, the second being the Rocky Mountain Douglas-fir. They may also attack Sitka, Engelmann, or white spruce. There are many different species of adelgids that produce different galls on different spruce species.

The Cooley spruce gall adelgid (Adelges cooleyi Gillette) is mainly a western species that usually alternate between white spruce and Douglas-fir. It is rare in eastern Canada. In Ontario, the galls are found mostly on Colorado spruce.

Identification[edit]

Diversity of colour of galls. They can be green,red and purple.

The infection is most noticeable on Cooley Spruce in the spring, May to June, when the galls appear. This infection may be mistakenly diagnosed to as caused by worms, grubs, or even as a sex organ of the spruce. Spruce pollen, however is released from a smaller structure that lacks needles. The galls are characterized by this pineapple-like form, with a length of 0.5 cm to 8 cm depending on the growth capacity of the tree. Most galls take on a pink, red or even deep purple colour while the needles usually remain green. The segments of the new bud that have this gall form will die after the aphids leave in the summer. Once on Douglas-fir, the adelgids consume the needles but do not form galls.

Infection[edit]

The end of a gall where infection was complete. The tissue has since become necrotic on this hardened remnant.

In the fall, the immature female adelgid, small, globular, and wingless (1.2-1.7 mm), finds a spruce to over-winter on. In the spring when the winter thaw occurs, the female matures and lays some eggs in what resemble sacks (totalling several hundred eggs) on the branches near the developing buds. These in fact are not sacks, but individual tufts of white waxy threads that protect the eggs. The females prefer areas on the spruce where they have greater protection from the elements, especially wind. These female individuals have an obvious patch of white wax wool as a covering. Their mouthparts consist of thread-like stylets which are used to penetrate into vascular bundles for feeding.

The end of a gall that had partial infection. Growth continues but it is convoluted.

Once hatched, the young nymphs begin feeding around the base of the needles in a new bud. The nymphs' saliva introduced into the plant trigger the changes in development of the plant, distinguished by the thickening and expansion of the basal portion of needles towards the characteristic gall form. When there are incomplete infections, the side of the bud facing the ground will be infected first. Only partially afflicted buds can support new growth after the affected tissue has died.

The chamber at the base of each needle is not connected with any other chamber in the gall. This differentiates this infection from that caused by the woolly adelgid genus Pineus, where the chambers are interconnected.

The nymphs are light brown when first hatched, becoming black when settled in gall chamber; they are flattened oval in shape and secrete a fringe of white wax. If a gall is opened in June, this white wax will be easily visible.

Life cycle[edit]

The life cycle of the gall adelgid requires six generations to complete, only two of which cause damage (nymph stages) and has two migration phases between the spruce and the Douglas-fir. On Douglas-fir, adults are about 0.1 cm long, oval, and light to dark brown in colour. At maturity they are completely covered with white, waxy wool and appear, from spring to fall, as stationary wool tufts on the underside of needles.1

While the chambers of the galls are closed, the nymphs actively feed and increase in size. By midsummer (August to September), the galls begin to dry out, the chambers open and winged forms of the adelgids emerge. These winged adult females have dark red-brown colour, with a heavily sclerotized thorax.3,4 These leave the original tree and most migrate to Douglas-fir trees. The abandoned galls continue to dry out and harden as the plant tissue dies. These dead galls are remnants that are never used again. The gall portion of partial infections dies, while the uninfected segment can continue growth, resulting in curved and convoluted shapes.

On Douglas-fir, eggs are laid on the needles and several generations of adelgids are produced. Yellow spots and bent needles result from feeding damage.2 The needles of light to moderately infested trees exhibit chlorotic mottling where individual adults have fed. Attacked needles may also be twisted. Severely infested foliage may be completely chlorotic and drop prematurely.1 Late in the summer, some of the woolly adelgids develop wings and fly back to spruce to deposit eggs, which produce the overwintering population. Others are wingless and remain on Douglas-Fir trees, where they produce other overwintering forms.2

Predation and control[edit]

Natural predators, such as ladybirds/ladybugs, hoverfly and lacewing larvae, spiders and mites do reduce adelgid and aphid populations to some degree.4

Spraying against these adelgids with chemicals is possible, and can be done in either the fall or the early spring. Foliar treatments of carbaryl (Sevin) and permethrin have been most effective in Colorado State University trials. Horticultural oils, which have also been very effective, can cause temporary discoloration of spruce needles.2

See also[edit]

More on the invasive woolly aphid species:

A University of Minnesota Pamphlet with image of mature woolly adelgid female: [1] and related pests

References[edit]

  • ^4 Cooley spruce gall aphid. 1977. Wood, C. Government of Canada. Department of the Environment. Canadian Forest Service, Pacific Forest Research Centre, Victoria, BC. Forest Pest Leaflet 06. 4 p. PDF form
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!