Articles on this page are available in 1 other language: Arabic (14) (learn more)

Overview

Brief Summary

Aedes albopictus (Stegomyia albopicta), the Asian tiger mosquito, is a is a important and dangerous vector for the transmission of several viral pathogens, including the West Nile virus, Yellow fever virus, St. Louis encephalitis, dengue fever, and Chikungunya fever, as well as transmitting the helminths that cause Brugian and Bancroftian filariasis. This small (2-10 mm long) mosquito gets its name from its characteristic black and white striped legs and body. They also have a distinctive white stripe down their back. The body size of individuals depends on larval density and nutritional availability. It is native to the tropical and subtropical areas of Southeast Asia; however, in the past couple of decades this species has invaded many countries throughout the world through the transport of goods and increasing international travel. The international trade of tires is responsible for effectively spreading these mosquitos, which travel in the water that gathers inside the tires when they are stored outside. Aedes albopictus is one of the 100 world's worst invasive species according to the Global Invasive Species Database. In Asia, the Asian tiger mosquito can be mistaken for other members of the subgenus Stegomyia, particularly the yellow fever mosquito Aedes aegypti (the most prevalent species in the tropics and subtropics), because both species display a similar black and white pattern. Aedes albopictus has become a significant pest in many communities because it closely associates with humans (rather than living in wetlands), and typically flies and feeds in the daytime in addition to at dusk and dawn. Aedes albopictus has proven to be very difficult to suppress or to control due to their remarkable ability to adapt to various environments, their close contact with humans, and their reproductive biology. The genus Aedes is undergoing reorganization according to recent morphological analyses by Reinert et al. (2004, 2009). This is controversial as it changes the name of Aedes albopictus to Stegomyia albopictus. Because this species is of great medical and public health importance, this proposed name change has been ignored by many scientists; at least one scientific journal, the Journal of Medical Entomology, has officially encouraged authors dealing with mosquitoes in the subfamily Aedinae to continue to use the traditional names unless they have particular reasons for doing so. (Editors of The Journal of Medical Entomology; Polaszek 2006; Weaver 2005; Wikipedia 2011; Wikipedia 2011b; WRBU)

  • CABI, 2009. Aedes albopictus [Original text by R. Eritja]. In: Invasive Species Compendium. Wallingford, UK: CAB International. Retrieved November 16, 2011 from http://www.cabi.org/isc/?compid=5&dsid=94897&loadmodule=datasheet&page=481&site=144.
  • Editors of The Journal of Medical Entomology. Policy on Names of Aedine Mosquito Genera and Subgenera. Entomological Society of America. Retrieved November 16, 2011 from http://www.entsoc.org/Pubs/Periodicals/JME/mosquito_name_policy
  • Nene, V.; Wortman, J. R.; Lawson, D.; et al., B; Kodira, C; Tu, ZJ; Loftus, B; Xi, Z et al. June 2007. Genome sequence of Aedes aegypti, a major arbovirus vector. Science 316 (5832): 1718–1723. doi:10.1126/science.1138878.
  • Polaszek A., 2006. Two words colliding: resistance to changes in the scientific names of animals–Aedes vs Stegomyia. Trends in Parasitology 22 (1): 8–9. doi:10.1016/j.pt.2005.11.003. PMID 16300998.
  • Reinert J.F., R.E. Harback, and I.J. Kitching, 2004. Phylogeny and classification of Aedini (Diptera: Culicidae), based on morphological characters of all life stages. Zoological Journal of the Linnean Society 142 (3): 289–368. doi:10.1111/j.1096-3642.2004.00144.x.
  • Reinert, J.F., Harbach, R.E. & Kitching, I.J. 2009. Phylogeny and classification of Aedini (Diptera: Culicidae). Zoological Journal of the Linnean Society 157, 700−794.
  • Weaver, S. 2005. Journal policy on names of aedine mosquito genera and subgenera. Am. J. Trop. Med. Hyg., 73(3), 2005, p. 481
  • Wikipedia, The Free Encyclopedia. 19 October 2011. “Aedes". Retrieved November 15, 2011 from http://en.wikipedia.org/w/index.php?title=Aedes&oldid=456322788
  • Wikipedia, The Free Encyclopedia. 9 November 2011. “Aedes albopictus". Retrieved November 15, 2011 from http://en.wikipedia.org/w/index.php?title=Aedes_albopictus&oldid=460114757
  • WRBU (Walter Reed Biosystematics Unit). Aedes. Retrieved November 16, 2011 from http://wrbu.si.edu/generapages/aedes.htm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

As explained by their colloquial name, Asian tiger mosquitos (Aedes albopictus) are native to Eastern Asia, stretching into India, Japan, and several islands in the Pacific (Australasia). Due to A. albopictus excellent ability to colonize new environments, it has been introduced to a variety of other places in the world. Over the past thirty years the species has spread to Italy and other regions in the Mediterranean basin, as well as parts of Africa, Madagascar, Brazil, Central America, the Caribbean, and most of the United States (specifically the East coast and the Midwest).

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Native ); ethiopian (Introduced ); neotropical (Introduced ); oceanic islands (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Aedes albopictus received its common name because of its distinguishable pattern of white and black stripes along it's palpus and tarsi. Beyond that, they are similar to most others in the Culicidae family (except for their pointed abdomens). Males are slightly smaller than females in the species, but they are very similar morphologically. The exception to this lies in the antennae (resting at the top of the mosquito, just above the mouthparts) which are much bushier in the males, and the maxillary palps which are longer in males than their proboscis (which isn’t needed for sucking). In females the palps are much smaller than their proboscis, which is crucial for taking blood meals. Aedes albopictus has a black proboscis, eyes, and labium all at the anterior end of the insect, while the black scutum contains a white line dissecting the dorsal part of the mosquito in half. Tergites behind the scutum are dark with bright white markings on them. Most legs are alternating in color, but some are solely black.

Eggs of Aedes albopictus are shaped much like cigars. They are blunt at the anterior end and taper at the posterior end. Each egg is spotted with large, smoothly rounded outer tubercles, with small cell fields scattered around the rest of the egg. The eggs eventually hatch into larva, which are sometimes called wigglers, which are very small and must be studied under a microscope. They are active feeders, and thus are equipped with mouth parts. They also have long, protruding breathing siphons used for oxygen acquisition. Larva are lighter in color when compared to most other mosquito species. They are very similar to Aedes aegypti, which is a closely related species. There are a few small differences that help to distinguish the two species, located on the mesothorax and metathorax. For example, Aedes albopictus has long pleural hair groups lacking a long spine that can be found on the other species. Pupae are also aquatic. They retain the breathing siphon, but appear as a dark ball at the other end.

Range length: 2 to 10 mm.

Average length: 4 mm.

Average wingspan: 2.7 mm.

Sexual Dimorphism: female larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Aedes albopictus chooses a habitat based on availability of food resources and availability of locations for reproduction and development. The species is capable of utilizing natural as well as artificial container habitats. It is perhaps most well known for utilizing tires, but it has since adapted the ability to develop in a range of natural and artificial areas including bird baths, clogged gutters, and litter.

Because members of this species are weak fliers, they remain within the same habitat their entire lives. Besides having a proper breeding and reproduction habitat, proper food resources must be available as well. This mosquito has developed very weak host specificity, and thus does not have trouble finding food in most environments.

Habitat Regions: tropical ; terrestrial ; freshwater

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Males of the species are not parasitic. They feed on nectars and sugar-rich plant juices. The females also feed on these juices, but need a blood meal to develop eggs. Asian tiger mosquitoes are efficient in that they can feed on many different species (of both mammals and birds). Aedes albopictus is an opportunistic feeder but prefers mammals above all else. Some of the most common species fed upon are domestic dogs, deer, rabbits and humans. They can feed on squirrels, opossums, bovines, raccoons, turtles, rats, and cats. This host variability allows this species to thrive in a wide range of environments.

When searching for a host, there are two phases. First, a female mosquito exhibits a nonspecific searching behavior until the perception of host stimulants. A mosquito then targets the host and begins an approach. Lastly, this mosquito lands on its host and thrusts its proboscis through the skin to find a vessel to feed from (making females of this species solenophagic).

Animal Foods: blood

Plant Foods: nectar

Primary Diet: herbivore (Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

A wide range of organisms prey Aedes albopictus as larvae when they are most defenseless. Various families of fungi infect larvae and tests have been done to see if they could be considered as a biological control agent of mosquitoes. Specifically, Coelomonoyces stegomyia and Tolypocladium cylindrosporum fungi cause damage to larval populations. Protozoan parasites can also cause damage, specifically to the midgut of larvae. Ascogregarina taiwanensis is one protozoan example, as well as other members from the genus Ascogregarina. Nematodes have been found parasitizing Asian tiger mosquitoes, but only in laboratory tests. Romanomermis culicivorax which has a history of burrowing into the cuticle of larval mosquitoes was introduced in experiments, but has not been found in nature parasitizing on Aedes albopictus. Other pathogens in bacterium and ciliate families have also been found to cause damage.

Aedes albopictus plays a large role in the spread of disease, as females have the potential to spread blood-borne diseases. This is of particular concern with zoonotic diseases as mosquitoes feed on many species of mammals and birds as well as humans.

Ecosystem Impact: parasite

Species Used as Host:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Many different species from different phylum prey upon Aedes albopictus. The majority of these predators consume mosquitoes in their larval phase. For example, a copepod predator, Mesocyclops leuckarti pilosa has been found to have the ability to take out an entire group of larva in a container. Another copepod, Macrocyclops albidus, which has a wide geographic range (unlike Mesocyclops leuckarti pilosa) is able to knock out a dense population in tire piles in 8 to 10 weeks. Some flatworms in the phylum Platyhelminthes also prey on larvae. Other mosquitoes including various species in the Toxorynchites genus, have shown an excellent ability to maintain Asian tiger mosquito populations and are being considered as a possible control species.

Bats and birds are the most common predators of adult mosquitoes. In certain areas, spiders are known to catch Aedes albopictus and feed on them.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There is very little communication that occurs between individuals of this species. Almost all communication is involved with mating. Antennae contain auditory receptors that allow the males to hear the whine of females which helps to locate them. Once in the same vicinity, males engage in lekking behavior, forming clusters in mid-air which invite females to mate. The males then secrete a substance that helps to officially begin the mating process. Individuals pair off, mate, and don't interact again.

Besides the auditory receptors, all mosquitoes in the species have compound eyes to help locate just about anything they need (mates, food, areas to lay eggs).

Communication Channels: acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Eggs of Aedes albopictus are laid along the side of artificial or man-made containers and will hatch when water levels rise above the location of the egg, submerging it. The eggs will hatch in water with low turbidity and a pH ranging from 5.2 to 7.6 (optimal range from 6.8 to 7.6). The ideal pool of water has a high organic nitrogen content for feeding upon. Larval size and duration of larval development are influenced by a variety of factors: temperature, food supply, crowding, and sex. Larval development includes four instars and can be as short as four days, or as long as 42 in a situation where the larva lacks adequate food, in which case it will die.

Larvae will eventually close themselves in pupaes, a process which under ideal conditions will last two days. This number can vary for males and females, though. The average number of hours for males is 32 to 36, while for females it is between 49 and 52. At this point an adult will emerge from the pupa, where it will soon look to mate. The adults have reached sexual maturity once they have left the pupa, and begin feeding and mating within two or three days.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Almost all studies on lifespan of Aedes albopictus have focused on the life of the female, so not much is known about the longevity of the male. It seems that environmental factors have a large effect on how long an individual can live. In a temperate climate with relatively high humidity, the average lifespan was between 30 and 40 days. In the laboratory, various experiments with different foods in different amounts could allow females to live up to 117 days. This was an extreme situation which is not possible in the natural environment.

Range lifespan

Status: captivity:
117 (high) days.

Typical lifespan

Status: wild:
30 to 40 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females can mate up to four times in a lifetime, depending on length of lifespan. Males typically have slightly shorter lifespans, but have fewer restrictions on mating. They can both mate multiple times with multiple individuals. Males will form leks, or swarms, a few feet off the ground, which will attract females. Males will secrete stimulants which provide one stimulus for ovarian development (blood meal provides the other stimulus). Mating will occur in flight and last for 5 to 15 seconds. At the end of the female’s gonotrophic cycle she oviposits her eggs, placing them at a few various locations.

Mating System: polygynandrous (promiscuous)

Once females emerge from pupae, they take in a blood meal within the first two the three days, which is vital for the development of eggs. There is no one mating season for Aedes albopictus, but the species is likely to mate during the rainy season which varies geographically. This assures the quickest development time for the eggs, which begin hatching once submerged in a stagnant pool of water. Females may lay from 45 to 200 eggs per year.

Breeding interval: Each gonotrophic cycle lasts about four days.

Breeding season: Breeding occurs during the rainy season, which varies geographically.

Range eggs per season: 45 to 200.

Average time to independence: 8 days.

Average age at sexual or reproductive maturity (female): 8 days.

Average age at sexual or reproductive maturity (male): 7 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

There is no parental investment once the female has laid her eggs in a suitable location.

Parental Investment: no parental involvement

  • 1995. Biology, Disease Relationships, and Control of Aedes albopictus. Washington D.C.: Pan American Health Orginization.
  • University of Florida. 2008. "Asian Tiger Mosquito" (On-line). Featured Creatures. Accessed March 22, 2010 at http://entnemdept.ufl.edu/creatures/aquatic/asian_tiger.htm.
  • Rai, K. 1999. Four Decades of Vector Biology. Notre Dame, IN: University of Notre Dame Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aedes albopictus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCGCGACAATGGTTATTTTCAACAAATCATAAAGATATTGGAACATTATACTTTATTTTCGGTATTTGACCTGGAATAGTCGGAACTTCACTAAGAGTTTTAATTCGTATTGAACTTAGACATCCTGGTATATTTATTGGAAATCATCAAATTTATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATCATAATTGGAGGATTTGGAAACTGACTAGTCCCCTTAATACTAGGAGCCCCTGATATAACTTTTCCTCGAATAAATAATATAAGTTTTTGAATATTACCCCCCTCTTTAACACTGCTGCTTTCTAGTTCTATAGTAGAAAACGGAGCTGGAACAGGGTGAACGGTTTATCCTCCTCTTTCTTCTGGAACAGCTCATGCTGGGGCTTCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCGGGAATCTCATCTATTTTAGGAGCAGTAAATTTTATTACAACTGTAATTAATATACGATCAGCTGGTATTACTCTTGACCGACTACCTTTATTTGTGTGATCAGTAGTAATTACAGCTATTTTATTACTTCTTTCTCTACCCGTATTAGCCGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCTTTTTTTGATCCAATTGGAGGGGGAGACCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTCTGCCAGGATTTGGAATAATTTCTCATATTATTACACAAGAAAGAGGAAAAAAGGAAACTTTTGGTACTTTAGGAATAATTTATGCTATATTAACAATTGGCTTATTAGGATTTATTGTATGAGCTCATCATATATTCACAGTTGGTATAGATGTTGATACTCGAGCTTATTTTACGTCTGCAACTATAATTATTGCGGTACCTACAGGAATTAAAATTTTTAGTTGATTAGCTACTCTTCATGGAACACAATTAACATATAGCCCTGCACTTTTATGATCTTTAGGATTTGTTTTTTTATTTACAGTTGGGGGATTAACCGGAGTAATTTTAGCTAATTCATCAATTGATATTGTACTTCACGATACATATTATGTAGTAGCCCATTTTCATTATGTATTATCTATAGGAGCAGTATTTGCTATTATAGCAGGATTTATTCATTGATATCCATTATTAACAGGAATAATTATAAATCCTTCATGATTAAAAGCTCAATTTACAATAATATTTATCGGAGTTAATTTAACTTTTTTTCCTCAACATTTTTTAGGATTAGCCGGAATACCTCGACGTTACTCTGATTTTCCAGATAGTTATTTAACTTGAAATATTATTTCTTCTTTAGGAAGAATAATTTCTTTATTTGCTATTATTTTCTTTTTATTTATTATTTGAGAAAGAATAATTACACAACGAACTCCTTCTTTCCCCATACAATTATCTTCATCTATTGAATGATATCATACTTTACCTCCTGCAGAACATACCTATTCAGAATTACCTCTTCTTTCTTCTAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aedes albopictus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 145
Specimens with Barcodes: 202
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stegomyia albopicta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Aedes albopictus is a notorious vector of various harmful pathogens to a number of species. All focus placed on the species concerns controlling it rather than conserving it.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Aedes albopictus acts as a parasite and a vector to a large variety of other species. Mosquitoes have a wide range of species they can feed upon. After being bitten by a mosquito, a host will become irritated in that spot due to a typical immune response against mosquito saliva. When feeding on a host, the species can pass on one of many different arboviruses, along with protzoans and filarial nematodes. Aedes albopictus is a known vector of dengue fever, yellow fever, West Nile virus, Eastern equine encephalitis, and Venezuelan equine encephalitis among many more. Mosquitoes are known to have caused outbreaks of Chikungunya Fever in both France and Italy. It is also notorious for vectoring parasitic roundworms Dirofilaria immitis, which cause heartworm in domestic dogs and cats. Because of the large number of pathogens Aedes albopictus carries and its ability to inhabit much of the world throughout the year, mosquitoes spread significant amounts of disease.

Negative Impacts: injures humans (bites or stings, carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Asian tiger mosquitoes provide no benefits to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Aedes albopictus

The Tiger mosquito or forest day mosquito, Aedes albopictus (Stegomyia albopicta), from the mosquito (Culicidae) family, is characterized by its black and white striped legs, and small black and white striped body. It is native to the tropical and subtropical areas of Southeast Asia; however, in the past couple of decades this species has invaded many countries throughout the world through the transport of goods and increasing international travel.[1] This mosquito has become a significant pest in many communities because it closely associates with humans (rather than living in wetlands), and typically flies and feeds in the daytime in addition to at dusk and dawn. The insect is called a tiger mosquito because its striped appearance is similar to a tiger. Aedes albopictus is an epidemiologically important vector for the transmission of many viral pathogens, including the West Nile virus, Yellow fever virus, St. Louis encephalitis,[2] dengue fever, and Chikungunya fever,[3] as well as several filarial nematodes such as Dirofilaria immitis.[4]

Contents

Description

Name and systematics

In 1894, a British-Australian entomologist, Frederick A. Askew Skuse, was the first to describe scientifically the Asian tiger mosquito, which he named Culex albopictus (lat. Culex “gnat, midge” and albopictus “white embroided”).[5][6] Later, the species was assigned to the genus Aedes (gr. άηδής, "unpleasant")[7] and referred to as Aedes albopictus.[8] Like the yellow fever mosquito, it belongs to the subgenus Stegomyia (Gr. στέγος, "covered, roofed", referring to the scales that completely cover the dorsal surface in this Subgenus, and μυία, "fly") within the Aedes genus.[9] In 2004, scientists explored higher-level relationships and proposed a new classification within the Aedes genus and Stegomyia was elevated to the Genus level, making Aedes albopictus now Stegomyia albopicta. This is, however, a controversial matter, and the use of Stegomyia albopicta versus Aedes albopictus is continually debated.[10][11][12]

Characteristics

The Asian tiger mosquito is about 2 to 10 mm length with a striking white and black pattern.[5][13][14] The variation of the body size in adult mosquitoes depends on the density of the larval population and food supply within the breeding water. Since these circumstances are seldom optimal, the average body size of adult mosquitoes is considerably smaller than 10 mm. For example, the average length of the abdomen was calculated to be 2.63 mm, the wings 2.7 mm, and the proboscis 1.88 mm through a study of 10 images from 1962 of both male and female mosquitoes.[15]

The males are roughly 20% smaller than the females, but they are morphologically very similar. However, as in all mosquito species, the antennae of the males in comparison to the females are noticeably bushier and contain auditory receptors to detect the characteristic whine of the female. The maxillary palps of the males are also longer than their proboscises whereas the females’ maxillary palps are much shorter. (This is typical for the males of the Culicinae.) In addition, the tarsus of the hind legs of the males is more silvery. Tarsomere IV is roughly three-quarters silver in the males whereas the females’ is only about 60% silver.

The other characteristics do not differentiate between sexes. A single silvery-white line of tight scales begins between the eyes and continues down the dorsal side of the thorax. This characteristic marking is the easiest and surest way to identify the Asian tiger mosquito.

The proboscis is dark colored, the upper surface of the end segment of the palps is covered in silvery scales, and the labium does not feature a light line on its underside. The compound eyes are distinctly separated from one another. The scutum, the dorsal portion of an insect’s thoracic segment, is black alongside the characteristic white midline. On the side of the thorax, the scutellum, and the abdomen there are numerous spots covered in white-silvery scales.

Such white-silvery scales can also be found on the tarsus, particularly on the hind legs that are commonly suspended in the air. The base of tarsomere I through IV has a ring of white scales, creating the appearance of white and black rings. On the fore legs and middle legs, only the first three tarsomeres have the ring of white scales whereas tarsomere V on the hind legs is completely white. The femur of each leg is also black with white scales on the end of the “knee”. The femurs of the middle legs do not feature a silver line on the base of the upper side, whereas, the femurs on the hind legs have short white lines on base of the upper side. The tibias are black on the base and have no white scales.

The terga on segments II through VI of the abdomen are dark and have an almost triangular silvery-white marking on the base that is not aligned with the silvery bands of scales on the ventral side of the abdomen. The triangular marking and the silvery band are only aligned on abdominal segment VII. The transparent wings have white spots on the base of the Costas. With older mosquito specimens, the scales could be partially worn off making the previously mentioned characteristics not stand out as much.[13][15]

The typical Aedes albopictus individual has a length of about 2 to 10mm.[14] As with other members of the mosquito family, the female is equipped with an elongated proboscis that she uses to collect blood to feed her eggs. The Asian tiger mosquito has a rapid bite that allows it to escape most attempts by people to swat it. By contrast the male member of the species primarily feeds on nectar.

The female lays her eggs near water; not directly into it as other mosquitoes do, but typically near a stagnant pool. However, any open container containing water will suffice for larvae development, even with less than an ounce of water in. It can also breed in running water, so stagnant pools of water are not its only breeding sites. It has a short flight range (less than 200 m), so breeding sites are likely to be close to where this mosquito is found.[16]

Similar species

Some mosquitoes in North America, such as Ochlerotatus canadensis, have a similar leg pattern.

In Europe, the mosquito Culiseta annulata, which is very common, but does not occur in high densities, can be mistaken for an Asian tiger mosquito because of its black and white ringed legs. However, this species is missing the distinctive white line that runs from the middle of its head and down the thorax. It is also considerably larger than Aedes albopictus, is not black and white, but rather beige and grey striped, and has wings with noticeable veins and four dark, indistinct spots.

In the eastern Mediterranean area, Aedes albopictus species can be mistaken with Aedes cretinus, which also belongs to the subgenus Stegomyia and uses similar breeding waters. Aedes cretinus also has a white stripe on the scutum, but it ends shortly before the abdomen, and also has two additional stripes to the left and right of the middle stripe. So far Aedes cretinus is only located in Cyprus, Greece, Macedonia, Georgia and Turkey.[17]

In Asia, the Asian tiger mosquito can be mistaken for other members of the subgenus Stegomyia, particularly the yellow fever mosquito Aedes aegypti (the most prevalent species in the tropics and subtropics), because both species display a similar black and white pattern. It can be hard to distinguish Aedes albopictus from the closely related Aedes scutellaris (India, Indonesia, Papua New Guinea, and the Philippines), Aedes pseudoalbopictus (India, Indonesia, Malaysia, Myanmar, Nepal, Taiwan, Thailand, and Vietnam) and Aedes seatoi (Thailand).[13][18]

Diet and host location

Bloated female at the end of a meal

Like other mosquito species, only the females require a blood meal to develop their eggs. Apart from that, they feed on nectar and other sweet plant juices just as the males do. In regards to host location, carbon dioxide and organic substances produced from the host, humidity, and optical recognition play important roles.

The search for a host takes place in two phases. First, the mosquito exhibits a nonspecific searching behavior until it perceives host stimulants, whereupon it secondly takes a targeted approach.[19] For catching tiger mosquitoes with special traps, carbon dioxide and a combination of chemicals that naturally occur in human skin (fatty acids, ammonia, and lactic acid) are the most attractive.[20]

The Asian tiger mosquito particularly bites in forests during the day and has been known as the forest day mosquito for this very reason. Depending upon region and biotype, there are differing active peaks, but for the most part they rest during the morning and night hours. They search for their hosts inside and outside of human dwellings, but are particularly active outside. The size of the blood meal depends upon the size of the mosquito, but it is usually around 2 microlitres.[19][21]

Aedes albopictus also bites other mammals besides humans and they also bite birds.[19][21] They are always on the search for a host and are both persistent and cautious when it comes to their blood meal and host location. Their blood meal is often broken off short without enough blood ingested for the development of their eggs. This is why Asian tiger mosquitoes bite multiple hosts during their development cycle of the egg, making them particularly efficient at transmitting diseases. The mannerism of biting diverse host species enables the Asian tiger mosquito to be a potential bridge vector for certain pathogens, for example, the West Nile virus that can jump species boundaries.

Natural enemies

Primarily, other mosquito larvae, flatworms, swimming beetles, fungi, ciliates, paramecia, protozoans which act as parasites, predatory copepods and spiders are natural enemies to Asian tiger mosquitoes.

Toxorhynchites speciosus larvae (an adult is shown here) feed on the larvae of Aedes albopictus.

Toxorhynchites larvae, a mosquito genus that does not suck blood, feeds upon other mosquito larvae and are often found with tiger mosquito larvae. Flatworms and also small swimming beetles are considered natural predators.[21]

Fungal relatives of Oomycetes, also known as water moulds from the genus Coelomomyces (Phylum Chytridiomycota, Order Blastocladiales), develop inside the visceral cavity of mosquito larvae. The species Coelomomyces stegomyiae was first found on the Asian tiger mosquito.[21]

Paramecia, or ciliates, can also affect Aedes albopictus larvae, and the first detected species was Lambornella stegomyiae (Hymenostomatida: Tetrahymenidae).[21] The virulence, mortality rate, and subsequent possibilities of Lambornella being implemented as a biological remedy to control Aedes albopictus, however, has conflicting views.[22][23]

Sporozoans of the genus Ascogregarina (Lecudinidae) infect the larval stage of mosquitoes. The species Ascogregarina taiwanensis was found in Asian tiger mosquitoes.[21] When the adult mosquitoes emerge from their pupal case, they leave the infectious intermediary stage of parasites in the water and close off the infection cycle. Infected adults are generally smaller than non-infected adults and have an insignificantly higher mortality rate; therefore, food supply and larval density apparently play a role. In competitive situations, an infection with sporozoans can also reduce the biological fitness of other non-infected mosquitoes. However, the use of the parasites as an effective biological remedy to control mosquito populations is implausible because it is essential that the host reaches the adult stage for the transmission of the parasites.[24]

Though they do not commonly occur in the natural habitats of Asian tiger mosquitoes, predatory copepods from the Cyclopidae family seem to willingly feed on them given the opportunity.[21] Relatives of different genera could therefore present an interesting possibility in the control of tiger mosquitoes.[25]

Predators of adult Aedes albopictus in Malaysia include various spider species. Up to 90% of the gathered spiders from rubber plantations and a cemetery fed upon Asian tiger mosquitoes. Whether the spiders would have an effect on the mosquito population is still unclear. Tiger mosquitoes were abundantly present despite the existence of the spiders.[26]

Distribution

Climatic adaptations

Although Aedes albopictus is native to tropical and subtropical regions, they are successfully adapting themselves to cooler regions. In the warm and humid tropical regions, they are active the entire year long; however, in temperate regions they hibernate over winter. Eggs from strains in the temperate zones are more tolerant to the cold than ones from warmer regions.[27][28] They can even tolerate snow and temperatures under freezing. In addition, adult tiger mosquitoes can survive throughout winter in suitable microhabitats.[29]

Invasive species

The Asian tiger mosquito originally came from Southeast Asia. In 1966, parts of Asia and the island worlds of India and the Pacific Ocean were denoted as the area of circulation for the Asian tiger mosquito.[30] Since then, it has spread to Europe, the Americas, the Caribbean, Africa and the Middle East. Aedes albopictus is one of the 100 world's worst invasive species according to the Global Invasive Species Database.[31]

The Aedes albopictus mosquito is not native to Australia and New Zealand.[32][33] In fact, the species was introduced there multiple times, but has yet to establish itself. This is due to the well organized entomological surveillance programs in the harbors and airports of these countries. Nevertheless, on the islands in the Torres Strait between Queensland, Australia and New Guinea Aedes albopictus has become domestic.[34]

In Europe the Asian tiger mosquito first emerged in Albania in 1979, where they were evidently introduced through a shipment of goods from China. In 1990–1991, they were most likely brought to Italy in used tires from Georgia (USA), and since then have spread throughout the entire mainland of Italy as well as parts of Sicily and Sardinia. Since 1999, they have established themselves on the mainland of France, primarily southern France. In 2002, they were also discovered in a vacation town on the island of Corsica, but did not completely establish themselves there until 2005. In Belgium, they were first detected in 2000, 2001 in Montenegro, 2003 in Canton Ticino in southern Switzerland and Greece, 2004 in Spain and Croatia, 2005 in the Netherlands and Slovenia, and 2006 in Bosnia and Herzegovina.[1] In the fall of 2007, the first tiger mosquito eggs were discovered in Rastatt (Baden-Wuerttemberg, Germany).[35] Shortly before, they were found in the northern Alps of Switzerland in Canton Aargau.[36] It is also being sighted increasingly in Malta during summer since 2010.

Asian tiger mosquitoes were first found in North America in a shipment of used tires at the port of Houston in 1985. Since then they have spread across southern USA, and as far up the East Coast as Maine.[37] This species is an introduced species in Hawaii as well, but has been there since before 1986.

In 1986, the Asian tiger mosquito was discovered in Brazil[38] and in 1988 in Argentina and Mexico,[39] as well. Other parts of Latin America where the Asian tiger mosquito was discovered are the Dominican Republic in 1993, Bolivia, Cuba, Honduras, and Guatemala in 1995, El Salvador in 1996, Paraguay in 1999, Panama in 2002, and Uruguay and Nicaragua in 2003.[40]

In South Africa, the species was detected in 1990.[41] In Nigeria it has been domestic since at least 1991.[42] It spread to Cameroon in 1999/2000,[43] to the Bioko Island of Equatorial Guinea in 2001,[44] and to Gabon in 2006.[45]

In the Middle East, the species was detected in the Lebanon in 2003 in Syria in 2005; the first record in Israel was published in 2003.[46]

Competition with established species

Aedes albopictus can outcompete and even eradicate other species with similar breeding habitats from the very start of its dispersal to other regions and biotopes.[47] In Kolkata, for example, it was observed in the 1960s that egg depositing containers were being settled by the Asian tiger mosquito in city districts where the malaria mosquito (genus Anopheles) and yellow fever mosquito (Aedes aegypti) had both been eliminated by the application of DDT.[48] The reason why, in this case, may be due to the fact that primarily the inner walls of the houses were treated with DDT to kill the mosquitoes resting there and fight the malaria mosquito. The yellow fever mosquito also lingers particularly in the inside of buildings and would have been also affected. The Asian tiger mosquito rests in the vicinity of human dwellings would therefore have an advantage over the other two species. In other cases, where the yellow fever mosquito was repressed by the Asian tiger mosquito, for instance in Florida, this explanation does not fit.[49][50] Other hypotheses include competition in the larval breeding waters, differences in metabolism and reproductive biology, or a major susceptibility to sporozoans (Apicomplexa).[51]

Another species, which was suppressed by the migrating Aedes albopictus was Aedes guamensis in Guam.[52]

The Asian tiger mosquito is similar, in terms of their close socialization with humans, to the common house mosquito (Culex pipiens). Among other differences in their biology, Culex pipiens prefers larger breeding waters and is more tolerant to cold. In this respect, there is probably not any significant competition or suppression between the two species.[51]

A possible competition among mosquito species that all lay their eggs in knotholes and other similar places (Aedes cretinus, Aedes geniculatus and Anopheles plumbeus) has yet to be observed.

In Europe, the Asian tiger mosquito apparently covers an extensive new niche. This means that there are no native, long-established species that conflict with the dispersal of Aedes albopictus.

Role as disease vectors

It is known that Aedes albopictus can transmit pathogens and viruses, such as the West Nile virus, Yellow fever virus, St. Louis encephalitis, dengue fever, and Chikungunya fever.[53]

The Asian tiger mosquito was responsible for the Chikungunya epidemic on the French Island La Réunion in 2005–2006. By September 2006, there were an estimated 266,000 people infected with the virus, and 248 fatalities on the island.[54] The Asian tiger mosquito was also the transmitter of the virus in the first and only outbreak of Chikungunya fever on the European continent. This outbreak occurred in the Italian province of Ravenna in the summer of 2007, and infected over 200 people.[55][56] Evidently, mutated strains of the Chikungunya virus are being directly transmitted through Aedes albopictus particularly well and in such a way that another dispersal of the disease in regions with the Asian tiger mosquito is feared.[57]

The tiger mosquito is also relevant to veterinary medicine. For example, tiger mosquitoes are transmitters of Dirofilaria immitis, a parasitic round worm that causes heartworm in dogs and cats.[58]

Control and suppression

Litter in roadside ditches makes an ideal breeding ground for the Asian tiger mosquito

Aedes albopictus has proven to be very difficult to suppress or to control due to their remarkable ability to adapt to various environments, their close contact with humans, and their reproductive biology.

An Ovitrap, a tool for the detection of Asian tiger mosquitoes. Their presence is confirmed through the eggs they lay on the wooden paddle. The brown granules in the water are a Bti preparation that will kill hatching mosquito larvae.

Efficient monitoring or surveillance is essential to prevent the spread and establishment of the species. In addition to the monitoring of ports, warehouses with imported plants, and stockpiles of tires, rest areas on highways and train stations should be monitored with appropriate methods.[59]

The control of the Asian tiger mosquitoes begins with destroying the places where they lay their eggs, which are never far from where people are being bitten, since they are weak fliers, with only about a 180-meters (200-yard) lifetime flying radius. Locate puddles that last more than three days, sagging or plugged roof gutters, old tires holding water, litter, bird baths, inlets to sewers and drainage systems holding stagnant water and any other possible containers or pools of standing water. Flower pots, standing flower vases, knotholes and other crevices that can collect water should be filled with sand or fine gravel to prevent mosquitoes from laying their eggs in them. Litter can also hold rain water and should be removed.

Any standing water in pools, catchment basins, etc., that cannot be drained, or dumped, can be periodically treated with properly labeled insecticides or Bacillus thuringiensis israelensis (Bti), often formed into doughnut shaped "mosquito dunks". Bti is a bacterium that produces toxins which are effective in killing larvae of mosquitoes and certain other Dipterans, while having almost no effect on other organisms. Bti preparations are readily available at farm, garden, and pool suppliers.

Flowing water will not be a breeding spot, and water that contains minnows is not usually a problem, because the fish eat the mosquito larvae. Dragonflies are also an excellent method of imposing control. Dragonfly larvae eat mosquito larvae in the water, and adults will snatch adult mosquitoes as they fly.

In any case, an efficient surveillance is essential to monitor the presence of tiger mosquitoes and the effect of control programs. So-called ovitraps are normally used for the monitoring of Aedes albopictus. They are black water containers with floating Styrofoam blocks or small wooden paddles that are in contact with the surface of the water. Female tiger mosquitoes lay their eggs on these surfaces. Through the identification of these eggs or of the larvae that hatch from these eggs in the laboratory, the presence and abundance of mosquito species can be estimated. Versions of these traps with an adhesive film (sticky traps) that catch the egg depositing mosquitoes make the analysis much easier and quicker, but are more complicated in terms of handling.[60][61] The results of ovitraps are often variable and depend on the availability of alternative egg depositing waters. Due to this, it is best to use them in large numbers and in conjunction with other monitoring methods.

To date, there are few effective traps for the adult Asian tiger mosquito. Those traps that catch other species of mosquitoes do not catch tiger mosquitoes efficiently. A new trap type has now been shown to catch significant numbers of Aedes albopictus.[62][63] This device, with the help of a ventilator, produces an upward air current of ammonia, fatty acids, and lactic acids that takes a similar form and smell of a human body. With the addition of carbon dioxide, the efficacy of the trap is increased. This means there is a suitable tool available for trapping adult tiger mosquitoes and, for example, examining the existence of viruses in the trapped mosquitoes. Previously, the mosquitoes had to be collected from volunteers to be studied, which is ethically questionable, especially during epidemics. Recent research also indicates this trap type may also have a use as a control tool; in a study in Cesena, Italy, the amount of biting tiger mosquitoes was reduced in places where traps were installed.[64]


References

  1. ^ a b Scholte, J.-E.; Schaffner, F. (2007). "Waiting for the tiger: establishment and spread of the Aedes albopictus mosquito in Europe". In Takken, W.; Knols, B. G. J. Emerging pests and vector-borne diseases in Europe 1. Wageningen Academic Publishers. ISBN 978-90-8686-053-1. 
  2. ^ Randolf, V.B.; Hardy, JL (1998). "Establishment and characterization of St Louis encephalitis virus persistent infections in Aedes and Culex mosquito cell lines". Journal of Genetic Virology 69 (9): 2189–2198. doi:10.1099/0022-1317-69-9-2189. PMID 2842432. 
  3. ^ Hochedez, P.; et al., S; Debruyne, M; Bossi, P; Hausfater, P; Brucker, G; Bricaire, F; Caumes, E (2006). "Chikungunya Infection in Travelers". Emerging Infectious Diseases 12 (10): 1565–1567. doi:10.3201/eid1210.060495. ISSN 1080-6040. PMC 3290953. PMID 17176573. 
  4. ^ Cancrini G, Frangipane di Regalbono A, Riccia I, Tessarin C, Gabrielli S and Pietrobelli M (2003). "Aedes albopictus is a natural vector of Dirofilaria immitis in Italy". Veterinary Parasitology 118 (3–4): 195–202. doi:10.1016/j.vetpar.2003.10.011. ISSN 0304-4017. 
  5. ^ a b Skuse, F. A. A. (1894). "The banded mosquito of Bengal". Indian Museum Notes 3 (5): 20. 
  6. ^ "Pollux: Archimedes Project Dictionary". Lewis & Short, Latin Dictionary. Archived from the original on 27 June 2007. 
  7. ^ "Aedes". Merriam-Webster Online Dictionary. 
  8. ^ Edwards, F. W. (1920). "Notes on the mosquitoes of Madagascar, Mauritius and Reunion". Bull. Ent. Res. 11 (2): 133–138. doi:10.1017/S0007485300044539. 
  9. ^ Theobald, F. V. (1901). A monograph of the Culicidae or mosquitoes. Volume 1. London: British Museum (Natural History).  Quoted in: Snow, K. (2001). "The names of European mosquitoes: Part 7". European Mosquito Bulletin 9: 4–8. 
  10. ^ Reinert, J. F.; et al., Ralph E.; Kitching, IAN J. (2004). "Phylogeny and classification of Aedini (Diptera: Culicidae), based on morphological characters of all life stages". Zool J Linn Soc. 142 (3): 289–368. doi:10.1111/j.1096-3642.2004.00144.x. 
  11. ^ Edman, J. D. (2005). "Journal Policy on Names of Aedine Mosquito Genera and Subgenera". J Med Entomol 42 (5): 511. doi:10.1603/0022-2585(2005)042[0511:JPONOA]2.0.CO;2. 
  12. ^ Schaffner, F. and Aranda, C. (2005): European SOVE – MOTAX group: Technical Note PDF 27 kB.
  13. ^ a b c Huang, Y.-M. (1968). "Neotype designation for Aedes (Stegomyia) albopictus (Skuse) (Diptera: Culicidae)". Proceedings of the Entomological Society of Washington 7 (4): 297–302. 
  14. ^ a b Walker, K. (22 December 2007). "Asian Tiger Mosquito (Aedes albopictus)". Pest and Diseases Image Library. Archived from the original on 21 March 2009. 
  15. ^ a b Belkin, John N. (1962) The Mosquitoes of the South Pacific (Diptera, Culicidae). University of California Press, Berkely und Los Angeles.
  16. ^ Nishida, G. M. and Tenorio, J. M. (1993) What Bit Me? Identifying Hawai'i's Stinging and Biting Insects and Their Kin. University of Hawaii Press, Honolulu. ISBN 978-0-8248-1492-2
  17. ^ Lane, J. (1982). "Aedes (Stegomyia) cretinus Edwards 1921 (Diptera: Culicidae)". Mosquito Systematics 14 (2): 81–84. 
  18. ^ Huang, Y.-M. (1969). Proceedings of the Entomological Society of Washington 71 (2). pp. 234–239. 
  19. ^ a b c Estrada-Franco, R.G. and Craig, G.B. (1995) Biology, disease relationship and control of Aedes albopictus. Pan American Health Organization, Washington DC: Technical Paper No. 42, ISBN 9275130426.
  20. ^ Feltner, H. and Ferrao, P. (2008): "Evaluating Efficacy of the BG Lure Attractant Using Three Mosquito Trap Designs in the City of Alexandria, Virginia", Presentation at the 33rd annual conference of the Mid-Atlantic Mosquito Control Association PDF 3.8 MB
  21. ^ a b c d e f g Hawley, W. A. (1988). "The biology of Aedes albopictus". J Am Mosq Control Assoc 1: 2–39. PMID 3068349. 
  22. ^ Arshad, H. H. and Sulaiman, I. (1995). "Infection of Aedes albopictus (Diptera: Culicidae) and Ae. aegypti with Lambornella stegomyiae (Ciliophora: Tetrahymenidae)". Journal of invertebrate pathology 66 (3): 303–6. doi:10.1006/jipa.1995.1105. PMID 8568285. 
  23. ^ Vythilingam, I. et al. (1996). "Distribution of 'Lambornella stegomyiae' in Malaysia and its Potential for the Control of Mosquitoes of Public Health Importance". Journal of Vector Ecology 21 (1): 89–93. 
  24. ^ Tseng, M. (2007). "Ascogregarine parasites as possible biocontrol agents of mosquitoes". Journal of the American Mosquito Control Association 23 (2 Suppl): 30–4. PMID 17853595. 
  25. ^ Marten, G. G. and Reid, J. W. (2007). "Cyclopoid Copepods". Journal of the American Mosquito Control Association 23 (2 Suppl): 65–92. PMID 17853599. 
  26. ^ Sulaiman, S. et al. (1995). "Serological Identification of the Predators of Adult Aedes albopictus (Skuse) (Diptera: Culicidae) in Rubber Plantations and a Cemetery in Malaysia". Journal of Vector Ecology 21 (1): 22–25. 
  27. ^ Hawley, WA; Pumpuni, CB; Brady, RH; Craig Jr, GB (1989). "Overwintering survival of Aedes albopictus (Diptera: Culicidae) eggs in Indiana". Journal of medical entomology 26 (2): 122–9. PMID 2709388. 
  28. ^ Hanson, S. M. and Craig, G. B. (1995). "Aedes albopictus (Diptera: Culcidae) Eggs: Field Survivorship During Northern Indiana Winters". J Med Ent 32 (5): 599–604. 
  29. ^ Romi, R; Severini, F; Toma, L (2006). "Cold acclimation and overwintering of female Aedes albopictus in Roma". Journal of the American Mosquito Control Association 22 (1): 149–51. PMID 16646341. 
  30. ^ Watson, M. S. (1967): Aedes (Stegomyia) albopictus: a literature review. Dep. Army, Ft. Detrick, MD, Misc. Publications 22: S. 1–38
  31. ^ 100 of the World's Worst Invasive Alien Species. Global Invasive Species Database. Retrieved 21 August 2008.
  32. ^ Russel, R. C. et al. (2005). "Aedes (Stegomyia) albopictus – A Dengue Threat for Southern Australia?". Commun. Dis. Intell. 29 (3): 296–298. 
  33. ^ Derraik, J. G. B. (2006). "A Scenario for Invasion and Dispersal of Aedes albopictus (Diptera: Culicidae) in New Zealand". Journal of medical entomology 43 (1): 1–8. PMID 16506441. 
  34. ^ Ritchie, S. A.; Moore, P; Carruthers, M; Williams, C; Montgomery, B; Foley, P; Ahboo, S; Van Den Hurk, AF et al. (2006). "Discovery of a Widespread Infestation of Aedes albopictus in the Torres Strait". Journal of the American Mosquito Control Association 22 (3): 358–65. PMID 17067032. 
  35. ^ Pluskota, B. et al. (2008). "First record of Stegomyia albopicta (Skuse) (Diptera: Culicidae) in Germany". Eur Mosq Bull 26: 1–5. 
  36. ^ Asiatische Tigermücke erstmals nördlich der Alpen gefunden. Welt (28 November 2007).
  37. ^ "Asian Tiger Mosquito". Ohio State University. Archived from the original on 16 January 2009. Retrieved 10 September 2007. 
  38. ^ Forattini, O. P. (1986). "Aedes (Stegomyia) albopictus (Skuse) identification in Brazil". Revista de Saude Publics 20 (3): 244–245. doi:10.1590/S0034-89101986000300009. PMID 3809982. 
  39. ^ Centers for Disease Control (1989). "Update: Aedes albopictus infestation United States, Mexico". Morb Mort Week Rpt 38 (25): 445–446. 
  40. ^ Cuéllar-Jiménez, M.E. et al. (2007). "Detectión de Aedes albopictus (Skuse) (Diptera: Culicidae) en la ciudad de Cali, Valle del Cauca, Colombia". Biomédica 27: 273–279. 
  41. ^ Cornel, AJ; Hunt, RH (1991). "Aedes albopictus in Africa? First records of live specimens in imported tires in Cape Town". Journal of the American Mosquito Control Association 7 (1): 107–8. PMID 2045799. 
  42. ^ Savage, HM; Ezike, VI; Nwankwo, AC; Spiegel, R; Miller, BR (1992). "First record of breeding populations of Aedes albopictus in continental Africa: Implications for arboviral transmission". Journal of the American Mosquito Control Association 8 (1): 101–3. PMID 1583480. 
  43. ^ Aedes (Stegomyia) albopictus (Skuse), a potential new Dengue vector in Southern Cameroon (2001). "Aedes (Stegomyia) albopictus (Skuse), a potential new Dengue vector in southern Cameroon". Emerging infectious diseases 7 (6): 1066–7. doi:10.3201/eid0706.010631. PMC 2631913. PMID 11747746. 
  44. ^ Toto, JC; Abaga, S; Carnevale, P; Simard, F (2003). "First report of the oriental mosquito Aedes albopictus on the West African island of Bioko, Equatorial Guinea". Medical and veterinary entomology 17 (3): 343–6. PMID 12941021. 
  45. ^ Short communication: First record of Aedes albopictus in Gabon, Central Africa (2007). "Short communication: First record of Aedes albopictus in Gabon, Central Africa". Tropical medicine & international health : TM & IH 12 (9): 1105–7. doi:10.1111/j.1365-3156.2007.01893.x. PMID 17714432. 
  46. ^ Haddad, N; Harbach, RE; Chamat, S; Bouharoun-Tayoun, H (2007). "Presence of Aedes albopictus in Lebanon and Syria". Journal of the American Mosquito Control Association 23 (2): 226–8. PMID 17847859. 
  47. ^ Lounibos, L. P. (2007). "Competitive displacement and reduction". Journal of the American Mosquito Control Association 23 (2 Suppl): 276–82. PMC 2212597. PMID 17853612. 
  48. ^ Gilotra, SK; Rozeboom, LE; Bhattacharya, NC (1967). "Observations on possible competitive displacement between populations of Aedes aegypti Linnaeus and Aedes albopictus Skuse in Calcutta". Bulletin of the World Health Organization 37 (3): 437–46. PMC 2554274. PMID 5301385. 
  49. ^ Hornby, JA; Moore, DE; Miller Jr, TW (1994). "Aedes albopictus distribution, abundance, and colonization in Lee County, Florida, and its effect on Aedes aegypti". Journal of the American Mosquito Control Association 10 (3): 397–402. PMID 7807083. 
  50. ^ O'Meara, GF; Evans Jr, LF; Gettman, AD; Cuda, JP (1995). "Spread of Aedes albopictus and decline of Ae. aegypti (Diptera: Culicidae) in Florida". Journal of medical entomology 32 (4): 554–62. PMID 7650719. 
  51. ^ a b Carrieri, Marco; Bacchi, Marta; Bellini, Romeo; Maini, Stefano (2003). "On the Competition Occurring Between Aedes albopictus and Culex pipiens (Diptera: Culicidae) in Italy". Environmental Entomology 32 (6): 1313. doi:10.1603/0046-225X-32.6.1313. 
  52. ^ Rozeboom, LE; Bridges, JR (1972). "Relative population densities of Aedes albopictus and A. guamensis on Guam". Bulletin of the World Health Organization 46 (4): 477–83. PMC 2480762. PMID 4538192. 
  53. ^ Hochedez, P; Jaureguiberry, S; Debruyne, M; Bossi, P; Hausfater, P; Brucker, G; Bricaire, F; Caumes, E (2006). "Chikungunya Infection in Travelers". Emerging infectious diseases 12 (10): 1565–7. doi:10.3201/eid1210.060495. PMC 3290953. PMID 17176573. 
  54. ^ ProMED-mail (2006) Chikungunya – Indian Ocean update (32) – 14 October 2006 – Archive Number 20061014.2953
  55. ^ ECDC/WHO (2007) Mission Report – Chikungunya in Italy PDF 1,46 MB
  56. ^ Angelini, R; Finarelli, AC; Angelini, P; Po, C; Petropulacos, K; Silvi, G; MacIni, P; Fortuna, C et al. (2007). "Chikungunya in north-eastern Italy: a summing up of the outbreak". Euro surveillance : bulletin europeen sur les maladies transmissibles = European communicable disease bulletin 12 (11): E071122.2. PMID 18053561. 
  57. ^ Tsetsarkin, KA; Vanlandingham, DL; McGee, CE; Higgs, S (2007). "A Single Mutation in Chikungunya Virus Affects Vector Specificity and Epidemic Potential". PLoS pathogens 3 (12): e201. doi:10.1371/journal.ppat.0030201. PMC 2134949. PMID 18069894. 
  58. ^ Gratz, N. G. (2004). "Critical review of the vector status of Aedes albopictus". Medical and Veterinary Entomology 18 (3): 215–27. doi:10.1111/j.0269-283X.2004.00513.x. PMID 15347388. 
  59. ^ Flacio et al. (2006): "Bericht 2006 zur Überwachung und Bekämpfung der asiatischen Tigermücke, Aedes albopictus, im Kanton Tessin." PDF 231 kB
  60. ^ Facchinelli, L; Valerio, L; Pombi, M; Reiter, P; Costantini, C; Della Torre, A (2007). "Development of a novel sticky trap for container-breeding mosquitoes and evaluation of its sampling properties to monitor urban populations of Aedes albopictus". Medical and veterinary entomology 21 (2): 183–95. doi:10.1111/j.1365-2915.2007.00680.x. PMID 17550438. 
  61. ^ Gama, Renata A.; Silva, Eric M.; Silva, Ivoneide M.; Resende, Marcelo C.; Eiras, Álvaro E. (2007). "Evaluation of the sticky MosquiTRAP for detecting Aedes (Stegomyia) aegypti (L.) (Diptera: Culicidae) during the dry season in Belo Horizonte, Minas Gerais, Brazil". Neotropical Entomology 36 (2): 294–302. doi:10.1590/S1519-566X2007000200018. PMID 17607465. 
  62. ^ Wilhelmine H. Meeraus, Jennifer S. Armistead & Jorge R. Arias (2008). "Field comparison of novel and gold standard traps for collecting Aedes albopictus in Northern Virginia". Journal of the American Mosquito Control Association 24 (2): 244–248. doi:10.2987/5676.1. PMID 18666532. 
  63. ^ Foley, K. (2007). "The BG-Sentinel Trap". Presentation at the Annual Meeting of the Virginia Mosquito Control Association. Archived from the original on 13 October 2007. 
  64. ^ Engelbrecht et al. (2009) Continuous trapping of adult Asian tiger mosquitoes (Aedes albopictus) with BG-Sentinel traps reduced the human landing rate and density indices in an urban environment in Cesena, Italy. Oral presentation at the 5th European Mosquito Control Association Workshop, Turin, Italy, 12 March 2009. Session 10.5.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!