Overview

Brief Summary

Taxon Biology

Eggs are laid singly on water surface by female; each egg has its own float. Larvae are fully aquatic (found mostly in agricultural and disturbed water pools) and feed by filtering microorganisms such as bacteria and algae. After pupation, adults emerge and mate in swarms. Males feed on nectar and other sugar sources, while females require a blood meal to develop eggs (anautogenous). Females of Anopheles gambiae sensu stricto are anthropophilic. A. gambiae transmits Plasmodium falciparum, the major causitive agent of human malaria.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

http://diptera.myspecies.info/users/torsten

Source: The Diptera Site

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The Anopheles gambiae complex is widely distributed throughout Africa.

Biogeographic Regions: ethiopian (Native )

  • Roberts, L., J. Janovy, Jr.. 2000. Foundations of Parasitology sixth edition. United States: McGraw-Hill Companies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sub-Saharan and Central Africa [Anopheles gambiae sensu stricto]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

http://diptera.myspecies.info/users/torsten

Source: The Diptera Site

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mosquitoes, like all insects, have three body segments: a head, thorax, and abdomen. The thoracic segment possesses three pairs of legs and a pair of wings used for flight. The hind wings are modified into balancing appendages called halteres. Male antennae have significantly more hair like structures, called setae, which aid in locating females.  The general coloration of this species is yellowish brown to brown with the last segment of the body normally all dark. The legs are spotted or speckled as an adult, and females normally have three pale bands on their palpi. The wings have pale scales that are creamy white and tinged with yellow. Anopheles gambiae larvae are 5-6 mm long and they are colored in much the same manner as the muddy water in which they are found. They breathe underwater through posterior spiracular plates on the 8th abdominal segment.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Individuals live throughout Africa, as long as water is readily available. Some species prefer fresh water, while others within the Anopheles gambiae complex live near water with high saline concentrations.

Habitat Regions: temperate ; tropical ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; brackish water

Wetlands: marsh ; swamp ; bog

Other Habitat Features: urban ; suburban ; agricultural ; riparian ; estuarine

  • Blackwell, A., S. Johnson. June, 2000. Electrophysiological investigation of larval water and potential oviposition chemo-attractants for Anopheles gambiae s.s.. Annals of Tropical Medicine and Parasitology, 94(4): 389-398.
  • Evans, A. 1938. Mosquitoes of the Ethiopian Region. London: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

All Anopheles gambiae females are temporary ectoparasites, living in the environment and coming to the host to feed. The females require blood meals to mature their eggs. Males, however, are non-parasitic and feed on plant fluids. Females do not display a tremendous amount of host specificity, but research indicates Anopheles gambiae preferentially feeds on humans. Females locate their hosts using a variety of sensory receptors, but respond to movement, carbon dioxide gradients, and sweat. Also, two odorant-binding proteins (OBP) have been isolated in Anopheles gambiae, which are hypothesized to aid female's search for human hosts.

Animal Foods: blood

Plant Foods: nectar; sap or other plant fluids

Primary Diet: carnivore (Sanguivore ); herbivore (Nectarivore , Eats sap or other plant foods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

These mosquitoes are disease vectors, and also provide food to predators.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Mosquitos are food for many types of birds, bats, frogs, lizards, and spiders.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Females locate their hosts using a variety of sensory receptors, but respond to movement, carbon dioxide gradients, and sweat. Also, two odorant-binding proteins (OBP) have been isolated in Anopheles gambiae, which are hypothesized to aid female's search for human hosts.

Perception Channels: visual ; tactile ; chemical

  • Konate, L., O. Faye, O. Gaye, M. Diouf, A. Diop. September, 1999. Observations on the feeding patterns and the alternative hosts selection of the malaria vectors in Senegal. Parasite, 6(3): 257-267.
  • Meijerink, J., M. Braks, A. Brack, W. Adam, T. Dekker. June, 2000. Identification of olfactory stimulants for Anopheles gambiae from human sweat samples. Journal of Chemical Ecology, 26(6): 1367-1382.
  • 2004. "World Health Organization" (On-line). Accessed 12/15/04 at http://www.who.int/tdr/research/progress/mal_str/default.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Anopheles gambiae development is holometabolous, with four larval instar stages followed by a non-feeding pupal stage where the organism undergoes complete metamorphosis from the larval form to the adult morphology. All mosquito larvae and pupae are aquatic. The larvae eat small pieces of organic matter, while the pupae eat nothing and do not move.

Development - Life Cycle: metamorphosis

  • Comstock, J. 1920. Introduction to Entomology. United States: The Comstock Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Adults mate almost immediately after emerging.

Adults mate soon after emerging from their pupae. Females require blood meals to mature their fertilized eggs. Some species in the Anopheles gambiae complex are freshwater breeders while others prefer saltwater, but mosquito eggs must remain in contact with water to survive. Females lay their eggs singly on the surface of the water, up to 200 eggs at a time. The presence of water is necessary for the development of the eggs and larvae. Some species in the Anopheles gambiae complex prefer small, shaded pools and rice fields to lay their eggs, while others prefer water with a high salinity concentration. Despite the site preference, the pools of water are almost always exposed to direct sunlight.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

  • Comstock, J. 1920. Introduction to Entomology. United States: The Comstock Publishing Company.
  • Roberts, L., J. Janovy, Jr.. 2000. Foundations of Parasitology sixth edition. United States: McGraw-Hill Companies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Mosquitoes detect carbon dioxide: malarial mosquitoes
 

The olfactory system of malarial mosquitoes detects carbon dioxide from potential hosts via a sensory mouth appendage, called a maxillary palp.

   
  "Blood-feeding insects, including the malaria mosquito Anopheles gambiae, use highly specialized and sensitive olfactory systems to locate their hosts. This is accomplished by detecting and following plumes of volatile host emissions, which include carbon dioxide (CO2). CO2 is sensed by a population of olfactory sensory neurons in the maxillary palps of mosquitoes and in the antennae of the more genetically tractable fruitfly, Drosophila melanogaster." (Jones et al. 2007:86)
  Learn more about this functional adaptation.
  • Jones, Walton D.; Cayirlioglu, Pelin; Grunwald Kadow, Ilona; Vosshall, Leslie B. 2007. Two chemosensory receptors together mediate carbon dioxide detection in Drosophila. Nature. 445(7123): 86-90.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Anopheles gambiae s.s.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles gambiae s.l.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 97
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Anopheles gambiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 51 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCGCGACAATGATTATTTTCAACAAATCATAAGGATATTGGAACTTTATATTTTATTTTCGGAGCTTGAGCTGGAATAGTAGGGACATCTTTAAGAATCCTAATTCGAGCTGAACTAGGACACCCTGGAGCATTTATTGGAGACGATCAAATTTATAATGTAATCGTTACTGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATGCTTCCTCCTTCATTAACACTTTTAATTTCTAGTAGTATAGTAGAAAACGGGGCTGGAACAGGATGAACTGTTTATCCTCCTCTATCTTCTGGAATTGCTCATGCTGGAGCTTCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCAGTAAATTTTATTACAACAGTAATTAATATACGGTCTCCAGGAATTACATTAGATCGAATACCATTATTTGTTTGATCGGTAGTTATTACAGCAGTATTATTATTATTATCATTACCAGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCTTTCTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACACTTATTCTGATTTTTTGGTCATCCAGAAGTATATATTTTAATTTTACCTGGATTCGGAATAATTTCGCATATTATTACTCAAGAAAGTGGAAAGAAGGAAACATTTGGAAACTTAGGAATAATCTATGCTATACTAGCAATTGGCTTACTTGGATTTATTGTTTGAGCTCATCATATATTTACAGTTGGAATAGACGTTGATACTCGAGCTTACTTTACATCAGCAACTATAATTATTGCTGTGCCAACTGGAATTAAGATTTTTAGTTGATTAGCTACATTACACGGAACACAATTGACTTATAGCCCAGCTATATTGTGAGCATTTGGATTCGTTTTCTTATTTACAGTTGGTGGTCTAACAGGAGTTGTACTAGCTAATTCATCTATTGATATTGTTCTTCACGATACTTATTATGTTGTTGCTCATTTCCATTATGTATTATCAATAGGAGCAGTATTTGCTATTATAGCAGGATTTGTACATTGATATCCATTATTAACTGGATTAACAATAAATCCAACTTGATTAAAAATTCAATTTTCTATTATATTTGTAGGAGTAAATTTAACATTTTTTCCTCAACATTTTTTAGGTTTAGCCGGAATACCTCGACGATATTCAGACTTTCCAGATAGCTATTTAACATGAAATGTAGTTTCTTCTTTAGGTAGTACAATCTCATTATTCGCTATTTTATACTTTTTATTTATTATTTGAGAAAGTATAATCACTCAACGAACTCCAGCTTTCCCTATACAATTATCATCATCAATTGAATGATACCATACCCTTCCTCCTGCAGAACATACTTATGCAGAGCTTCCTCTATTAACTAATAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles gambiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 54
Specimens with Barcodes: 178
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In the United States, mosquitoes are often thought of as a pest and a nuisance. Anopheles gambiae is much more than a simple pest, it is responsible for the transmission of malaria and other serious diseases throughout Africa. Anopheles gambiae transmits Plasmodium falciparum, which is the most severe of the four malarial agents. Although this disease was wiped out in the United States, it remains a world health hazard. There are an estimated 300 to 500 million cases of malaria each year and as a result, 1.5 to 2.7 million deaths worldwide. Continental sub-Sahara Africa, however, accounts for roughly 90% of all malarial cases worldwide.

Negative Impacts: injures humans (bites or stings, carries human disease); household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Anopheles gambiae have no known positive economic impact on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Anopheles gambiae

The tube-like heart (green) extends along the body, interlinked with the diamond-shaped wing muscles (also green) and surrounded by pericardial cells (red). Blue depicts cell nuclei.

Anopheles gambiae is a complex of at least seven morphologically indistinguishable species of mosquitoes in the genus Anopheles. This complex was recognised in the 1960s and includes the most important vectors of malaria in sub-Saharan Africa particularly of the most dangerous malaria parasite, Plasmodium falciparum.[2] It is one of the most efficient malaria vectors known.

This species complex consists of:[3]

Despite being morphologically indistinguishable, individual species of Anopheles gambiae complex exhibit different behavioural traits. For example, the Anopheles quadriannulatus, is generally considered to be zoophilic, (taking its blood meal from animals) whereas Anopheles gambiae sensu stricto is generally anthropophilic (taking its blood meal from humans). Identification to the individual species level using the molecular methods of Scott et al. (1993)[4] can have important implications in subsequent control measures.

Recently a new cryptic subgroup - the Goundry subgroup- of Anopheles gambiae sensu stricto has been described.[5]

Anopheles gambiae in the strict sense[edit]

An. gambiae s.s. has been discovered to be currently in a state of diverging into two different species — the Mopti (M) and Savannah (S) strains — though as of 2007, the two strains are still considered to be a single species. The An. gambiae s.s. genome has been sequenced three times, once for the M strain, once for the S strain, and once for a hybrid strain.[6][7] Currently, ~90 miRNA have been predicted in the literature (38 miRNA officially listed in miRBase) for An. gambiae s.s. based upon conserved sequences to miRNA found in Drosophila.

The mechanism of species recognition appears to be sounds emitted by the wings and identified by Johnston's organ.[8]

Historical note[edit]

An. gambiense invaded northeastern Brazil in 1930, which led to a malaria epidemic in 1938/1939.[9] The Brazilian government assisted by the Rockefeller Foundation in a programme spearheaded by Fredrick Soper eradicated these mosquitoes from this area. This effort was modeled on the earlier success in eradication of Aedes aegypti as part of the yellow fever control program. The exact species involved in this epidemic has been identified as An. arabiensis.[10]

References[edit]

  1. ^ Giles, G.M. (1902). A handbook of the gnats or mosquitoes giving the anatomy and life history of the Culicidae together with descriptions of all species noticed up to the present date. John Bale, Sons & Danielsson, Limited. London, United Kingdom. 530pp
  2. ^ "Anopheles gambiae complex". Walter Reed Army Institute of Research. 
  3. ^ Besansky NJ, Powell JR, Caccone A, Hamm DM, Scott JA, Collins FH (July 1994). "Molecular phylogeny of the Anopheles gambiae complex suggests genetic introgression between principal malaria vectors". Proc. Natl. Acad. Sci. U.S.A. 91 (15): 6885–8. doi:10.1073/pnas.91.15.6885. PMC 44302. PMID 8041714. 
    Wilkins EE, Howell PI, Benedict MQ (2006). "IMP PCR primers detect single nucleotide polymorphisms for Anopheles gambiae species identification, Mopti and Savanna rDNA types, and resistance to dieldrin in Anopheles arabiensis". Malar. J. 5 (1): 125. doi:10.1186/1475-2875-5-125. PMC 1769388. PMID 17177993. 
  4. ^ C. Fanello, F. Santolamazza & A. Della Torre (2002). "Simultaneous identification of species and molecular forms of the Anopheles gambiae complex by PCR-RFLP". Medical and Veterinary Entomology 16 (4): 461–4. doi:10.1046/j.1365-2915.2002.00393.x. PMID 12510902. 
  5. ^ Yakob L (2011) Epidemiological consequences of a newly discovered cryptic subgroup of Anopheles gambiae.Biol Lett
  6. ^ "Anopheles gambiae: First genome of a vector for a parasitic disease". Genoscope. 
  7. ^ Lawniczak, M. K., et al. (Oct 22, 2010). "Widespread divergence between incipient Anopheles gambiae species revealed by whole genome sequences.". Science 330 (6003): 512–4. doi:10.1126/science.1195755. PMC 3674514. PMID 20966253. 
  8. ^ Pennetier C, Warren B, Dabiré KR, Russell IJ, Gibson G (2009) "Singing on the wing" as a mechanism for species recognition in the malarial mosquito Anopheles gambiae. Curr. Biol.
  9. ^ Killeen GF (October 2003). "Following in Soper's footsteps: northeast Brazil 63 years after eradication of Anopheles gambiae". Lancet Infect Dis 3 (10): 663–6. doi:10.1016/S1473-3099(03)00776-X. PMID 14522266. 
  10. ^ Parmakelis A, Russello MA, Caccone A, et al. (January 2008). "Historical analysis of a near disaster: Anopheles gambiae in Brazil". Am. J. Trop. Med. Hyg. 78 (1): 176–8. PMID 18187802. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!