Overview

Distribution

 South to Argentina & Chile; West Indies; Galapagos Islands (cf. BDWD http://www.catalogueoflife.org/annual-checklist/show_species_details.php?record_id=5452482)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

http://diptera.myspecies.info/users/torsten

Source: The Diptera Site

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Cochliomyia macellaria in Illinois

Cochliomyia macellaria Fabricius: Calliphoridae, Diptera
(observations are from Robertson and Graenicher; the maggot of this fly is called the 'Secondary Screw-Worm')

Anacardiaceae: Rhus copallina [pist sn fq] (Rb); Apiaceae: Cicuta maculata sn fq (Rb), Eryngium yuccifolium sn (Rb), Pastinaca sativa sn fq (Rb), Sium suave sn (Rb); Apocynaceae: Apocynum cannabinum [plab sn] (Rb); Asclepiadaceae: Asclepias verticillata [plpr sn] (Rb); Asteraceae: Aster anomalus sn (Rb), Aster drummondii sn/fp (Gr), Aster lanceolatus sn/fp (Rb, Gr), Aster pilosus sn fq (Rb), Aster puniceus sn/fp (Gr), Aster sagittifolius sn (Rb), Aster salicifolius sn (Rb), Bidens aristosa sn (Rb), Bidens cernua sn (Rb), Boltonia asterioides sn (Rb), Eupatorium altissimum sn (Rb), Eupatorium perfoliatum sn/fp (Rb, Gr), Eupatorium serotinum sn (Rb), Euthamia graminifolia sn/fp (Rb, Gr), Helenium autumnale sn/fp (Gr), Oligoneuron rigidum sn (Rb), Pseudognaphalium obtusifolium sn (Rb), Solidago canadensis sn fq (Rb), Solidago nemoralis sn (Rb), Tanacetum vulgare sn/fp (Gr); Caprifoliaceae: Symphoricarpos orbiculatus sn (Rb); Fabaceae: Dalea candida sn (Rb); Hamamelidaceae: Hamamelis virginiana sn/fp (Gr); Lamiaceae: Lycopus americanus sn (Rb), Pycnanthemum pilosum sn (Rb), Pycnanthemum tenuifolium sn (Rb), Pycnanthemum virginianum sn (Rb); Polygonaceae: Persicaria hydropiperoides sn (Rb), Persicaria pensylvanica sn (Rb); Ranunculaceae: Clematis virginiana [stam sn fq] (Rb); Rosaceae: Crataegus intricata sn (Rb); Verbenaceae: Verbena urticifolia sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Cochliomyia macellaria (C. macellaria larvae) is prey of:
Arachnida
Reduviidae
Phalangidae
Macrocheles muscadomesticae
Staphylinidae
Carabidae
Geomysaprinus belioculus
Euspilotus aenicollis
Hister punctiger
Camponotus
Saprinus
Saprinus pennsylvanicus
Sinea complexa
Saprinus discoidalis
Silpha truncata
Proctacanthella leucopogon
Pogonomyrmex desertorum
Solenopsis xyloni
Idiasta
Pogonomyrmex apache
Myrmecocystus mimicus
Iridomyrmex pruinosum

Based on studies in:
Costa Rica (Carrion substrate)
USA: New Mexico, Aden Crater (Carrion substrate)
USA: Texas, Hueco Mountains (Carrion substrate)
USA: New Mexico, White Sands (Carrion substrate)

This list may not be complete but is based on published studies.
  • L. F. Jiron and V. M. Cartin, 1981. Insect succession in the decomposition of a mammal in Costa Rica. J. New York Entomol. Soc. 89:158-165, from p. 163.
  • M. McKinnerney, 1977. Carrion communities in the northern Chihuahuan Desert. M.S. thesis. University of Texas-El Paso, Texas; and 1978, Carrion communities in the northern Chihuahuan Desert. Southw. Nat. 23:563-576, from thesis and p. 571.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Cochliomyia macellaria (C. macellaria larvae) preys on:
Mammalia
carcass
Cardinalis

Based on studies in:
Costa Rica (Carrion substrate)
USA: New Mexico, Aden Crater (Carrion substrate)
USA: Texas, Hueco Mountains (Carrion substrate)
USA: New Mexico, White Sands (Carrion substrate)

This list may not be complete but is based on published studies.
  • L. F. Jiron and V. M. Cartin, 1981. Insect succession in the decomposition of a mammal in Costa Rica. J. New York Entomol. Soc. 89:158-165, from p. 163.
  • M. McKinnerney, 1977. Carrion communities in the northern Chihuahuan Desert. M.S. thesis. University of Texas-El Paso, Texas; and 1978, Carrion communities in the northern Chihuahuan Desert. Southw. Nat. 23:563-576, from thesis and p. 571.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cochliomyia macellaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Cochliomyia macellaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGACAATGGTTATTTTCTACTAATCATAAAGATATTGGTACTTTATATTTCATTTTTGGAGCTTGATCTGGAATAGTAGGAACTTCTCTAAGAATTCTAATTCGAGCAGAATTAGGACATCCTGGAGCATTAATTGGAGAT---GACCAAATTTATAATGTAATTGTTACAGCTCACGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATACTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTTTACCTCCTGCATTAACTTTATTATTAGTAAGTAGTATAGTAAAAAACGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTATCTTCTAATATTGCTCACGGAGGAGCTTCAGTTGATCTAGCTATTTTCTCTCTTCATTTAGCCGGAATTTCATCAATTTTAGGAGCAGTAAATTTCATTACAACTGTAATTAATATACGATCAACAGGAATTACATTCGATCGAATGCCTTTATTCGTATGATCAGTAGTAATTACTGCTCTTTTACTTTTATTATCTTTACCAGTTTTAGCCGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAACACTTCATTCTTTGATCCAGCCGGAGGAGGAGATCCAATTTTATACCAACACTTATTTTGATTCTTTGGACACCCTGAAGTATATATTTTAATTCTACCTGGATTTGGAATAATTTCACATATTATTAGTCAAGAATCAGGAAAGAAGGAAACATTCGGATCTTTAGGAATGATTTATGCTATATTAGCTATTGGTTTATTAGGATTTATTGTTTGAGCTCATCACATGTTTACTGTTGGAATAGACGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!