Physical Description
Type Information
Syntype for Lucilia primaveris Shannon & del Ponte, 1926
Catalog Number: USNM 40814
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Pinned
Collector(s): R. Shannon
Year Collected: 1926
Locality: San Isidro; B. a, Buenos Aires, Argentina
Catalog Number: USNM 40814
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Pinned
Collector(s): R. Shannon
Year Collected: 1926
Locality: San Isidro; B. a, Buenos Aires, Argentina
- Syntype: 1926. Revista del Instituto Bactereol?gico, Buenos Aires. 4: 40.
© Smithsonian Institution, National Museum of Natural History, Department of Entomology
Trusted
Syntype for Lucilia mera Shannon & del Ponte, 1926
Catalog Number: USNM 40813
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Pinned
Collector(s): R. Shannon & E. Shannon
Year Collected: 1926
Locality: San Pedro de; Jujuy, Jujuy, Argentina
Catalog Number: USNM 40813
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Pinned
Collector(s): R. Shannon & E. Shannon
Year Collected: 1926
Locality: San Pedro de; Jujuy, Jujuy, Argentina
- Syntype: 1926. Revista del Instituto Bactereol?gico, Buenos Aires. 4: 40.
© Smithsonian Institution, National Museum of Natural History, Department of Entomology
Trusted
Ecology
Associations
Known predators
Phaenicia eximia (P. eximia larvae) is prey of:
Arachnida
Reduviidae
Phalangidae
Macrocheles muscadomesticae
Staphylinidae
Carabidae
Geomysaprinus belioculus
Euspilotus aenicollis
Hister punctiger
Camponotus
Based on studies in:
Costa Rica (Carrion substrate)
This list may not be complete but is based on published studies.
Arachnida
Reduviidae
Phalangidae
Macrocheles muscadomesticae
Staphylinidae
Carabidae
Geomysaprinus belioculus
Euspilotus aenicollis
Hister punctiger
Camponotus
Based on studies in:
Costa Rica (Carrion substrate)
This list may not be complete but is based on published studies.
- L. F. Jiron and V. M. Cartin, 1981. Insect succession in the decomposition of a mammal in Costa Rica. J. New York Entomol. Soc. 89:158-165, from p. 163.
© SPIRE project
Source:
SPIRE
Trusted
Known prey organisms
Phaenicia eximia (P. eximia larvae) preys on:
toad carrion
Mammalia
Based on studies in:
Costa Rica: Guanacaste (Carrion substrate)
Costa Rica (Carrion substrate)
This list may not be complete but is based on published studies.
toad carrion
Mammalia
Based on studies in:
Costa Rica: Guanacaste (Carrion substrate)
Costa Rica (Carrion substrate)
This list may not be complete but is based on published studies.
- L. F. Jiron and V. M. Cartin, 1981. Insect succession in the decomposition of a mammal in Costa Rica. J. New York Entomol. Soc. 89:158-165, from p. 163.
- B. W. Cornaby, 1974. Carrion reduction by animals in contrasting tropical habitats. Biotropica 6:51-63, from pp. 54, 59-62.
© SPIRE project
Source:
SPIRE
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Lucilia eximia
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CGACAATGGTTATTTTCAACTAATCATAAAGATATTGGTACTTTATATTTTATTTTCGGGGCTTGATCCGGTATAATTGGAACTTCTTTAAGAATTCTAATTCGAGCCGAATTAGGACACCCCGGAGCACTAATTGGTGAC---GATCAAATTTATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTCCTTCCCCCTGCATTAACTTTACTATTAGTAAGTAGTATAGTAGAAAACGGGGCTGGAACAGGATGAACAGTTTACCCTCCCTTATCTTCTAATATCGCCCATGGTGGAGCTTCTGTAGATTTAGCTATTTTTTCTCTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCAGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGAATTACTTTTGATCGAATACCATTATTTGTTTGATCTGTAGTAATTACAGCTTTATTACTTTTATTATCTTTACCAGTATTAGCCGGGGCTATTACTATACTTTTAACTGACCGAAATCTTAACACCTCATTCTTTGACCCCGCTGGAGGAGGAGACCCAATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTAGTCAAGAATCAGGAAAGAAGGAAACATTTGGGTCATTAGGAATGATTTACGCTATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCACATCATATATTCACTGTAGGAATAGACGTTGATACTCGAG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Lucilia eximia
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 55
Species With Barcodes: 1
Public Records: 11
Specimens with Barcodes: 55
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
