Physical Description

Type Information

Syntype for Lucilia primaveris Shannon & del Ponte, 1926
Catalog Number: USNM 40814
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Pinned
Collector(s): R. Shannon
Year Collected: 1926
Locality: San Isidro; B. a, Buenos Aires, Argentina
  • Syntype: 1926. Revista del Instituto Bactereol?gico, Buenos Aires. 4: 40.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Lucilia mera Shannon & del Ponte, 1926
Catalog Number: USNM 40813
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Pinned
Collector(s): R. Shannon & E. Shannon
Year Collected: 1926
Locality: San Pedro de; Jujuy, Jujuy, Argentina
  • Syntype: 1926. Revista del Instituto Bactereol?gico, Buenos Aires. 4: 40.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Known predators

Phaenicia eximia (P. eximia larvae) is prey of:
Arachnida
Reduviidae
Phalangidae
Macrocheles muscadomesticae
Staphylinidae
Carabidae
Geomysaprinus belioculus
Euspilotus aenicollis
Hister punctiger
Camponotus

Based on studies in:
Costa Rica (Carrion substrate)

This list may not be complete but is based on published studies.
  • L. F. Jiron and V. M. Cartin, 1981. Insect succession in the decomposition of a mammal in Costa Rica. J. New York Entomol. Soc. 89:158-165, from p. 163.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Phaenicia eximia (P. eximia larvae) preys on:
toad carrion
Mammalia

Based on studies in:
Costa Rica: Guanacaste (Carrion substrate)
Costa Rica (Carrion substrate)

This list may not be complete but is based on published studies.
  • L. F. Jiron and V. M. Cartin, 1981. Insect succession in the decomposition of a mammal in Costa Rica. J. New York Entomol. Soc. 89:158-165, from p. 163.
  • B. W. Cornaby, 1974. Carrion reduction by animals in contrasting tropical habitats. Biotropica 6:51-63, from pp. 54, 59-62.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lucilia eximia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGACAATGGTTATTTTCAACTAATCATAAAGATATTGGTACTTTATATTTTATTTTCGGGGCTTGATCCGGTATAATTGGAACTTCTTTAAGAATTCTAATTCGAGCCGAATTAGGACACCCCGGAGCACTAATTGGTGAC---GATCAAATTTATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTCCTTCCCCCTGCATTAACTTTACTATTAGTAAGTAGTATAGTAGAAAACGGGGCTGGAACAGGATGAACAGTTTACCCTCCCTTATCTTCTAATATCGCCCATGGTGGAGCTTCTGTAGATTTAGCTATTTTTTCTCTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCAGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGAATTACTTTTGATCGAATACCATTATTTGTTTGATCTGTAGTAATTACAGCTTTATTACTTTTATTATCTTTACCAGTATTAGCCGGGGCTATTACTATACTTTTAACTGACCGAAATCTTAACACCTCATTCTTTGACCCCGCTGGAGGAGGAGACCCAATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTAGTCAAGAATCAGGAAAGAAGGAAACATTTGGGTCATTAGGAATGATTTACGCTATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCACATCATATATTCACTGTAGGAATAGACGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lucilia eximia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 55
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!