Overview

Brief Summary

Myiasis is infection with the larval stage (maggots) of various flies. Flies in several genera may cause myiasis in humans. Dermatobia hominis (Diptera: Oestridae) is the primary human bot fly; its distribution ranges from Mexico into South America. Chrysoma bezziana (Diptera: Calliphoridae) is the Old World screwworm and Cochliomyia hominovorax (Diptera: Calliphoridae) is the primary screwworm fly in the New World. Cordylobia anthropophaga (Diptera: Calliphoridae) is known as the tumbu fly. Flies in the genera Cuterebra (Diptera: Oestridae), Oestrus (Diptera: Oestridae) and Wohlfahrtia (Diptera: Sarcophagidae) are parasites of other animals that also occasionally infect humans.

Adults of the Human Bot Fly (Dermatobia hominis) are free-living flies. Adults capture blood-sucking arthropods (such as mosquitoes) and lay eggs on their bodies, using a glue-like substance for adherence. Bot fly larvae develop within the eggs, but remain on the vector until it takes a blood meal from a mammalian or avian host. Newly-emerged bot fly larvae then penetrate the host's tissue. The larvae feed in a subdermal cavity for 5-10 weeks, breathing through a hole in the host's skin. Mature larvae drop to the ground and pupate in the environment. Larvae tend to leave their host during the night and early morning, probably to avoid desiccation. After approximately one month, the adults emerge to mate and repeat the cycle.

(Centers for Disease Control Parasites and Health website)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Dermatobia hominis are endemic to the highlands of Central and South America. Their range extends from southern Mexico to northern Argentina.

Biogeographic Regions: neotropical (Native )

  • Bangsgaard, R., H. Bengt, E. Krogh, S. Heegaard. 2000. Palpebral myiasis in a Danish traveler caused by the human bot-fly (Dermatobia hominis). Acta Ophthalmologica Scandinavia, 78: 487-489.
  • Murdoch, D., R. Pilgrim, G. Paltridge. 1996. Cutaneous myiasis due to Dermatobia hominis: case report. New Zealand Medical Journal, 109: 465-466.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult D. hominis are 12-18 mm in length, are bluish in color, and resemble bumble-bees. They have three ocelli and a pair of large compound eyes, which are sexually dimorphic in that eyes are situated closer together in males than in females. Also, females are normally larger in size than males and bear a pseudovipositor at their posterior. As in other muscomorphans, the antennae of adult D. hominis each bear an arista -a tenuous, plumose projection- on the second of its three segments. The knob-like halteres, or functionally reduced hind-wings that are characteristic of dipterans, are also present. Peculiarly, the ancestral mouthparts have been lost in adult D. hominis, as well as in other cuterebrines.

Dermatobia hominis larvae, or maggots, are identified by the pyriform shape, the transverse rows of spines on their tegument, sclerotized mouthparts, and the pair of projecting spiracles at the posterior end. They may reach 25 mm in length and 7 mm in diameter.

Range length: 12 to 18 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Platt, S., C. Schmidhauser. 1997. Local treatment of human botfly myiasis in Belize. Economic Botany, 51(1): 88-89.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Dermatobia hominis, also known as the tropical warble fly or human bot fly, are found in tropical and semi-tropical areas of the New World. These places are typically coffee-growing highlands, as D. hominis prefer hilly, moist, and cool secondary-forests.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest ; scrub forest

Other Habitat Features: agricultural

  • Catts, E. 1982. Biology of the New World Bot Flies: Cuterebridae. Annual Review of Entomology, 27: 313-338.
  • Dunn, L. 1934. Prevalence and importance of the tropical warble fly, Dermatobia hominis Linn., in Panama. Journal of Parasitology, 20: 219-226.
  • Roberts, L., J. Janovy, Jr.. 2000. Gerald D. Schmidt & Larry S. Robert's Foundations of Parasitology, Sixth Edition. Boston: McGraw-Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Like other species in the family Oestridae, adult D. hominis are non-feeding.

Larvae are endoparasites of birds and mammals. They bore into the skin of their hosts, either through pre-existing lesions in the skin or through active piercing, and become established in the subcutaneous layer. Breathing air through their posterior spiracles and employing body spines as anchors, D. hominis larvae use their sclerotized mouthparts to bore deeper into the host's body as they feed and grow on host tissue exudates. Feeding location on the host is not specific, as larvae have been found to establish at almost any exposed surface of the host's body, from the scrotum to the eye, although more frequently at more exposed regions of the body such as the leg and the back.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

  • Yildiz, M., M. Basar, M. Hokelek, H. Basar, Z. Akalin. 1997. Scrotal myiasis. British Journal of Urology, 80: 493-494.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Due to their unique egg dispersal strategy using mobile porters, D. hominis host range is more generalized than other bot-fly species. They have been found to parasitize many warm-blooded vertebrates and some birds (e.g., toucans and turkeys). And as suggested by the name, human bot fly, humans also frequently serve as hosts.

Ecosystem Impact: parasite

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

Dermatobia hominis reach sexual maturity soon after emergence from the puparium, and viable eggs may be laid as of the second day of adulthood. An egg, after being glued onto a paratenic host for transport to the vertebrate host requires 5-9 days to develop, after which it requires an additional 27-128 days to pass through the three larval stages inside the definitive host. Normally, about 12, 18, and 12 days are required for a larva to pass through the first, second, and third instars respectively. At the end of the larval period, the third larval instar exits the definitive host's body and drops onto the soil, after which it burrows deeply into the soil or other available debris and pupates within a period of 2-3 days. At the end of the pupation period, which takes somewhere between 27-78 days depending on seasonal variation in soil temperature, the adult emerges and becomes sexually active within two hours.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating in D. hominis begins with "pouncing" displays performed by a male in response to sexual readiness in a female, which is indicated by the protraction of the latter's abdomen or pseudovipositor. Copulation is normally contingent upon female receptiveness; in other words, females seem to exhibit behavior suggestive of mate choice. Laboratory experimentation has revealed that males can pair with multiple mates in the average ratio of 1 male to 2.8 females. Perhaps due to the polygynous mating system, competition among males has been observed in the form of "pouncing" disturbances directed at copulating pairs. Copulation terminates after about 9 minutes.

Mating System: polygynous

Dermatobia hominis exhibit a homometabolous life-cycle. Being non-feeding and having a short adult life span (3-4 days in the laboratory), this stage in the life-cycle of D. hominis is allocated primarily towards reproductive efforts. Females lay 800 to 1,000 eggs.

Unique from other bot-fly species, which lay their eggs directly on the host or in the host's environment, is the peculiar egg dispersal strategy exhibited by females of the human bot fly; this process involves the use of porters (i.e., paratenic hosts) as vectors for transporting eggs onto the bodies of the vertebrate hosts. Under this strategy, a female captures a porter and glues her eggs onto one side of its abdomen using a water-insoluble glue, after which the porter is released without being harmed. Being sensitive to a sudden rise in temperature, the eggs instantly hatch upon contact with the warm-blooded body of a definitive host as the porter lands onto it, usually to feed on blood. Within 5-10 minutes, the larvae bore their way into the definitive host's body, often via the wounds inflicted by the porter's feeding, and establish themselves in the subcutaneous layer. Forty-eight species of flies--of which about half are mosquitoes--and a tick are reported to be involved in this paratenic relationship with female D. hominis. Porter species are often zoophilous, diurnal, moderate in size, and not too active. Potential advantages of this egg dispersal strategy include the protection of eggs from the elements and egg-parasitism, the prevention of egg loss from host grooming, and the adaptive allocation of energy in reproductive efforts.

Range eggs per season: 800 to 1000.

Key Reproductive Features: semelparous ; sexual ; fertilization (Internal ); oviparous

  • Bangsgaard, R., H. Bengt, E. Krogh, S. Heegaard. 2000. Palpebral myiasis in a Danish traveler caused by the human bot-fly (Dermatobia hominis). Acta Ophthalmologica Scandinavia, 78: 487-489.
  • Catts, E. 1982. Biology of the New World Bot Flies: Cuterebridae. Annual Review of Entomology, 27: 313-338.
  • Curran, C. 1939. The Human Bot Fly--How did this extraordinary insect develop the habit of forcing a mosquito to deposit its eggs for it?. Natural History, June: 45-48.
  • Roberts, L., J. Janovy, Jr.. 2000. Gerald D. Schmidt & Larry S. Robert's Foundations of Parasitology, Sixth Edition. Boston: McGraw-Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Dermatobia hominis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Dermatobia hominis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCGCAACAATGGCTCTTCTCTACTAACCATAAAGATATTGGAACATTATATTTTATTTTCGGTGCTTGATCTGGAATAATTGGAACTTCATTAAGAATCCTTATTCGTGCAGAATTAGGACACCCAGGAGCTCTAATTGGAGACGATCAAATTTATAATGTTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCTCCTGACATAGCATTTCCACGAATAAACAATATAAGTTTTTGATTATTGCCTCCAGCTTTAACACTTTTACTGGTAAGAAGTATAGTAGAAAATGGAGCTGGTACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATGGAGGGGCTTCAGTAGATTTAGCTATTTTTTCCTTACACTTAGCAGGAATCTCATCAATTTTAGGTGCTGTAAATTTTATTACAACTGTAATTAATATACGATCTGTTGGAATTACATTTGACCGCATACCATTATTTGTATGATCTGTAGTAATTACAGCTCTTTTACTTCTTCTATCACTTCCAGTACTTGCTGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCGGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCAGGATTCGGAATAATCTCCCATATTATTAGTCAAGAATCTGGAAAAAAGGAAACATTTGGATCATTAGGAATAATTTATGCTATATTAGCTATTGGTTTACTAGGATTTATTGTATGAGCTCATCACATATTTACAGTAGGGATAGATGTTGATACACGAGCTTACTTCACATCAGCAACAATAATTATTGCAGTACCAACAGGTATCAAAATTTTTAGATGATTAGCTACCCTTTATGGTACACAATTAAACTATTCACCAGCTACATTATGAGCTCTAGGATTTGTATTTTTATTTACTGTAGGAGGTCTTACAGGAGTTGTTTTAGCAAATTCATCAATTGATATTATCTTACATGATACATATTATGTAGTAGCCCATTTTCATTATGTTCTTTCAATAGGAGCAGTATTTGCTATTATAGGAGGATTTGTACATTGATATCCACTATTTACTGGACTAACAATAAATAATACAATATTAAAAAGTCAATTTACTATTATATTCATTGGAGTTAATCTAACATTTTTTCCTCAACATTTTTTAGGATTAGCAGGAATACCTCGACGATATTCAGATTATCCAGATGCTTATACTACATGAAATGTAATTTCAACAATTGGATCTACAATTTCACTATTAGGAATTTTATTTTTCTTATTTATTATTTGAGAAAGTTTAATGTCCCAACGTCAAGTTATATACCCAATTCAATTAAATTCATCAATTGAATGACTACAAAATACTCCCCCAGCAGAACATAGTTACTCAGAACTTCCTTTATTAACTAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Infestation by D. hominis maggots, a form of myiasis, is a common condition in both humans and domesticated animals. It has been said that they surpass all other cuterebrines in terms of economic and public health importance. Dermatobia hominis larvae parasitize diverse regions on the human body, from the ankle to the brain of infants (through fontanelles, or gaps between incompletely formed bones of an infant's cranium) often causing tissue damage and bouts of severe pain from the boring activity of the larvae. In rare cases, fatalities have resulted, particularly from cerebral myiasis. Furthermore, lesions, or warbles, caused by the infestation may lead to secondary infections, which, if not treated with antibiotics, may result in fatality or other health complications. Treatment is by removal of larvae. Care must be excercised in doing so, since the larvae anchor themselves into the flesh using the spines on their tegument. Rupturing of larvae as the result of improper removal may lead to severe infection.

Although D. hominis infestation occurs among a broad range of domesticated animals, from dogs to sheep, their negative effects on the cattle industry is most severe in areas of the Neotropics. As a single animal may concurrently be infested by upwards of thousands of maggots, it is not suprising that losses have resulted from cattle mortality, from the rendering of the animal as unfit for slaughter, and from the destruction of the animal's hide. Negative impacts had been strong enough to cause a cessation in herding operations in Panama.

Negative Impacts: injures humans (bites or stings, causes disease in humans ); causes or carries domestic animal disease

  • McMullin, P., L. Cramer, G. Benz, P. Jeromel, S. Gross. 1989. Control of Dermatobia hominis infestation in cattle using an ivermectin slow-release bolus. Veterinary Record, 124: 465.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dermatobia hominis

The human botfly, Dermatobia hominis, (Greek δέρμα, skin + βίος, life, and Latin hominis, of a human) is one of several species of fly the larvae of which parasitise humans (in addition to a wide range of other animals, including other primates[1]). It is also known as the torsalo or American warble fly,[1] even though the warble fly is in the genus Hypoderma and not Dermatobia and is a parasite on cattle and deer instead of humans.

Dermatobia fly eggs have been shown to be vectored by over 40 species of mosquitoes and muscoid flies, as well as one species of tick;[2] the female captures the mosquito and attaches its eggs to its body, then releases it. Either the eggs hatch while the mosquito is feeding and the larvae use the mosquito bite area as the entry point, or the eggs simply drop off the muscoid fly when it lands on the skin. The larvae develop inside the subcutaneous layers, and after approximately eight weeks, they drop out to pupate for at least a week, typically in the soil. The adults are large flies resembling bumblebees. They are easily recognized because they lack mouthparts (as is true of other Oestrid flies).

This species is native to the Americas from Southeastern Mexico (beginning in central Veracruz) to northern Argentina, Chile, and Uruguay[1] though it is not abundant enough (nor harmful enough) ever to attain true pest status. Since the fly larvae can survive the entire eight-week development only if the wound does not become infected, it is rare for patients to experience infections unless they kill the larva without removing it completely. It is even possible that the fly larva may itself produce antibiotic secretions that help prevent infection while it is feeding.[citation needed]

Extracted human botfly larva. The arrow points to the larva's mouthparts.

Remedies[edit]

Recently, physicians have discovered that venom extractor syringes can remove larvae with ease at any stage of growth. As these devices are a common component of first-aid kits, this is an effective and easily accessible remedy.[3]

A larva has been successfully removed by first applying several coats of nail polish to the area of the larva's entrance, weakening it by partial asphyxiation.[4]

Covering the location with adhesive tape would also result in partial asphyxiation and weakening of the larva, but is not recommended because the larva's breathing tube is fragile and would be broken during the removal of the tape, leaving most of the larva behind.[4]

The easiest and most effective way to remove botfly larvae is to apply petroleum jelly over the location, which prevents air from reaching the larva, suffocating it. It can then be removed with tweezers safely after a day.

Oral use of ivermectin, an antiparasitic avermectin medicine, has proved to be an effective and non invasive treatment that leads to the spontaneous emigration of the larva.[5] This is especially important for cases where the larva is located at inaccessible places like inside the inner canthus of the eye.

Map of Human Botfly Region

See also[edit]

References[edit]

  1. ^ a b c "Human Bot Fly Myiasis". U.S. Army Center for Health Promotion and Preventive Medicine. August 2007. Retrieved 2008-10-09. [dead link]
  2. ^ Piper, Ross (2007). "Human Botfly". Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals. Westport, Connecticut: Greenwood Publishing Group. pp. 192–194. ISBN 0-313-33922-8. OCLC 191846476. Retrieved 2009-02-13. 
  3. ^ Boggild, Andrea K.; Jay S. Keystone and Kevin C. Kain (August 2002). "Furuncular myiasis: a simple and rapid method for extraction of intact Dermatobia hominis larvae". Clinical Infectious Diseases 35 (3): 336–338. doi:10.1086/341493. PMID 12115102. Retrieved 2008-10-09. 
  4. ^ a b Bhandari, Ramanath; David P. Janos and Photini Sinnis (March 2007). "Furuncular myiasis caused by Dermatobia hominis in a returning traveler". The American journal of tropical medicine and hygiene 76 (3): 598–9. PMC 1853312. PMID 17360891. Retrieved 2008-10-09. 
  5. ^ Wakamatsu, Wakamatsu; Pierre-Filho (October 2005). "Ophthalmomyiasis externa caused by Dermatobia hominis: a successful treatment with oral ivermectin". Eye 20 (9): 1088–90. doi:10.1038/sj.eye.6702120. Retrieved 2013-06-01. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!