Overview

Comprehensive Description

Differential diagnosis

Melanostoma are medium-sized hoverflies, very similar to Platycheirus. They differ from Platycheirus by having metasternum reduced, with deep posterior incision on each side; facial pruinosity neitehr punctate nor rippled; protibia and protarsi slender; and femora or tibiae without bristles or modified pili.

Species with antennae yellowish ventrally; abdomen black with yellow maculae; face and frons shiny; arista almost bare.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Very well-spread species in the Nearctic region (Alaska to New Brunswick, south to Washington and Virginia), the Palaearctic (most of Europe), North Africa and Asia, east to Pacific coast.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Technical Description

From original description (Linnaeus 1758) in Latin.

M. antennis fetariis nuda, thorace fubaeneo fuscescente immaculato, abdomine maculis 8 lutescentibus,
Fn. fvec. 1092, 1093.
Habitat inter Aphides, quibus victitat.
Variat abdominis dorfo 4, 3, & 2 paribus macularum ferruginearum: iisque I. tetragonis, I. trigonis, I. rotundis.

From Vockeroth (1992).

Species small, slender or very slender, with entirely black head and thorax; usually with distinct pairs of yellow to orange maculae on terga 2-4 but with maculae reduced or absent in some specimens.

Head: Eye bare. Frons of male broadly pollinose along eye margins, otherwise shining to subshining; frons of female with pair of distinct to obscure pollinose maculae just below mid length; maculae variable in size and separated medially or confluent. Face slightly receding below, with low broad pollinose to shining tubercle, otherwise moderately densely pollinose to almost shining. Antenna varying from entirely black to yellow with basoflagellomere brownish above.

Thorax: Thoracic hairs short, usually entirely yellow, rarely dark on dorsum. Scutum mostly shining, slightly pollinose anteriorly and laterally. Scutellum shining. Ventral scutellar fringe complete. Pleura slightly pruinose. Anterior anepisternum, meron, katatergum, and metasternum bare. Dorsal and ventral katepisternal pile patches widely separated. Metasternum with deep posterior incision on each side so only narrow anterior fascia and median vitta sclerotized. Wing membrane entirely microtrichose or with small bare areas near base, at most extreme base of cell c and about basal half of cell bm partly bare. Metacoxa without posteromedial apical pile tuft. Legs slender, with basotarsomere of metaleg scarcely swollen, without outstanding hairs or bristles, varying from almost entirely black to entirely yellow except for black coxae.

Abdomen unmargined, variable in proportions and markings. Male with abdomen nearly parallel sided, from two to five times as long as greatest width. Terga 2-4 usually with distinct yellow to yellow-orange maculae, but with maculae in some specimens darkened and pollinose or submetallic, or, in some arctic specimens, indicated only by dark brown slightly shining areas; maculae of tergum 2 well-separated from anterior and posterior margins, usually extending broadly to lateral margins but in some specimens reduced in size, indistinct, or absent; terga 3 and 4 usually with distinct subquadrate or subrectangular basal yellow maculae extending to lateral margins on at least anterior half of their length; maculae in some specimens reduced in size and not reaching lateral margins, in many arctic specimens maculae scarcely distinguishable.

Female with abdomen varying from nearly parallel sided to oval, from 1.7 to 2.5 times as long as greatest width; terga 2-5 usually with yellow spots distinct but in some specimens reduced in size or absent, especially in arctic specimens; maculae of tergum 2 elongate to rounded, well-separated from anterior and posterior margins but anteriorly in some specimens extending narrowly to lateral margins; terga 3 and 4 usually with yellow basal maculae of characteristic shape, strongly narrowed posterolaterally and extending only narrowly to lateral margins; tergum 5 usually with large to small anterolateral maculae. Sterna with variable markings, ranging from entirely black to yellow with narrow complete or partial brown median vitta.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Citation

Melanostoma mellinum (Linnaeus, 1758).

Linnaeus, C. (1758) Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Ed. 10, Vol. 1. 824 pp. L. Salvii, Holmiae [= Stockholm].

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nomenclature and Synonymy

Synonyms:

Musca mellina Linnaeus, 1758: 594.

Syrphus albimanus Fabricius, 1781: 434.

Melanostoma angustatum Williston, 1887: 50.

Melanostoma bellum Giglio-Tos, 1892: 3.

Melanostoma cruciata Bigot, 1884:81.

Melanostoma melanderi Curran, 1930: 64.

Melanostoma angustatoides Kanervo, 1934: 123.

Melanostoma obscuripes Kanervo, 1934: 123.

Melanostoma melanatus Kanervo, 1934: 124.

Syrphus lachrymosus Harris, 1835: 598.

Melanostoma montivagum Johnson, 1916: 78.

Melanostoma pachytarse Bigot, 1884: 80.

Melanostoma pallitarse Curran, 1926: 83.

Cheilosia parva Williston, 1882: 307.

Melanostoma ochripes Bigot, 1884: 55.

Melanostoma pruinosa Bigot, 1884: 79.

Melanostoma bicruciata Bigot, 1884: 79.

Syrphus concolor Walker, 1851: 296.

Musca facultas Harris, 1780: 49.

Syrphus laevigatus Meigen, 1838: 134.

Syrphus mellarius Meigen, 1822: 328.

Syrphus melliturgus Meigen, 1822: 329.

Syrphus minutus Macquart, 1829: 234.

Melanostoma mellinum var. nigricornis Strobl, 1893: 172.

Syrphus unicolor Macquart, 1829: 236.

Melanostoma interruptum Matsumura, 1919: 138.

Melanostoma inornatum Matsumura, 1919: 132.

Melanostoma ochiaianum Matsumura, 1919: 136.

Melanostoma ogasawarae Matsumura, 1919: 137.

Melanostoma sachalinense Matsumura, 1919: 139.

Syrphus mellinus Fabricius, 1775: 771.

Melanostoma deficiens Szilady, 1940: 59.

Melanostoma dilatatum Szilady, 1940: 59.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Lectotype for Melanostoma melanderi Curran
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): A. Melander
Year Collected: 1918
Locality: Wash. ilwaco, Washington, United States
  • Lectotype: Thompson. 1979.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Looks Alike

Species very similar to Melanostoma scalare, but abdomen more oval. In males, abdomen does not extend beyond wings (van Veen, 2004).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Melanostoma species live in herbaceous vegetation, often in areas dominated by grass (van Veen, 2004).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Heiss (1938) said that larvae of genera Melanostoma and Platycheirus "are nocturnal and show a strong preference for quite moist situations. When disturbed, they become very active and display the most remarkable speed of travel that the writer has observed in any syrphid."

The two genera seem to present a transition group in food habits. Metcalf (1916) records finding a large number of Melanostoma mellinum larvae on rape plants infested with Myzus persicae, but the aphids were much fewer in numbers than the predators. He reared the larvae in the laboratory on Aphis cornifoliae Fitch and Myzus persicae, but the larvae refused other species. Davidson (1922) observed that M. stegnum raised on a diet of aphids became undersized imagines, suggesting that aphids were not their normal diet. He records the observation of Curran that the larvae of Melanostoma obscurum consumed both aphids and decomposing chickweed and that they were more successful on the chickweed. In Davidson's cages, there was no decomposing plant material. He makes an interesting suggestion: "It is possible that several of the species of Melanostoma are both phytophagous and entomophagous in the larval stage, and that even these are undergoing a transition in habit, changing from plant to insect feeders. The nocturnal habit of feeding and desire for concealment suggests that it may not have been so long ago that the larvae normally lived in obscurity inside plants, or in the open in darker situations than growing plants normally afford."

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Melanostoma mellinum in Illinois

Melanostoma mellinum Linnaeus: Syrphidae, Diptera
(observations are from Robertson and Graenicher; an alternative spelling for the scientific name of this fly is Melanostoma mellina)

Asteraceae: Antennaria neglecta [unsp sn/fp] (Gr), Cirsium arvense sn/fp (Gr); Brassicaceae: Capsella bursa-pastoris sn (Rb); Caryophyllaceae: Cerastium nutans sn (Rb); Parnassiaceae: Parnassia glauca sn/fp (Gr); Ranunculaceae: Ranunculus fascicularis sn (Rb); Salicaceae: Salix discolor [unsp sn/fp] (Gr); Valerianaceae: Valeriana edulis ciliata (Gr)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults visit the flowers of grasses and other plants (van Veen, 2004). Larvae of M. mellinum prey mainly on aphids (Aphididae) but also on larvae of coleoptera, on adults of diptera and on jumping plant lice (Psyllidae) (Rojo et al. 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

From eggs deposited on rape, and larvae found in moist places near the ground under the leaves of rape, Metcalf (1916) reared this species in the laboratory on Myzus persicae and Aphis cornifoliae Fitch from C ornus. His records do not absolutely establish whether the larvae were aphidophagous in the field or were feeding on rotting material in the moist situations at the base of the plants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Larva (from Metcalf 1916).

Length, when well extended, 8-9 mm, width 2.5 mm. Color lettuce-green, a little more yellowish mediad. Since the integument is unusually transparent, the viscera show through the body wall with unusual plainness. The integument is finely papillose without vestiture. The segmental spines consist of a fleshy, subconical base surmounted by a slender, blunt peg of about equal height, the whole small, light colored, entirely inconspicuous. The posterior respiratory process is about 0.3 mm broad at the end, about 0.17 mm in height and elevated above the surface of the last segment only to a length of about 0.1 mm. The circular plate is evident, and the pairs of spiracles are unusually short: less than twice as long as broad. The interspiracular ornamentation consists of four pairs of short rounded nodules. There is a moderate emargination between the two posterior spiracular plates.

Puparium (from Heiss 1938).

Length, 6 mm, width at anterior end, 2.25 mm, height, 1.7 mm. General body form clavate, sloping in narrow ridge down to posterior respiratory process. Color yellowish green, translucent, with tendency towards opalescence. Under either the highest power of a binocular miscroscope or under the low power of a compound microscope, the pupal respiratory horn is clearly evident as a small reddish brown projection rising from the dorsal plate of the operculum. It is slightly longer than its diameter. The eight oval areas figured by Metcalf (Fig. 19) are difficult to see on the specimen examined by the writer. The features of the posterior respiratory process are the same as those of the larva, but the spiracles are surrounded by a black triangle.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Phylogeny

In the phylogenetic analysis by Mengual et al. (2008), Melanostoma species were grouped together forming a clade sister-group of the genus Argentinomyia. Both genera were resolved related with Xanthandrus.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Melanostoma mellinum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 38
Specimens with Barcodes: 165
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Melanostoma mellinum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTTTATTTGGAGCTTGAGCAGGTATAGTAGGAACATCATTAAGTATACTAATTCGTGCTGAACTTGGTCATCCAGGTGCTTTAATTGGAGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGACTACTCCCTCCTTCATTAACTTTATTATTAGTAAGAAGTATAGTAGAAAATGGAGCTGGTACAGGATGAACTGTTTACCCTCCTCTTTCTTCTAGTATTGCTCACGGTGGGGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGTATATCTTCAATTCTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGTTCTACAGGTATTTCTTATGATCGAATACCATTATTTGTTTGATCAGTTGTAATTACAGCTTTACTTCTTTTATTATCATTACCAGTTCTTGCTGGAGCAATTACAATATTATTAACAGACCGAAATTTAAATACTTCTTTTTTTGATCCAGCCGGAGGAGGAGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Melanostoma mellinum

Melanostoma mellinum, is a very common species of hoverfly found in many parts of Britain, Europe, North Africa, Asia and North America.

A small species, the wingspan range recorded is between 4.75 and 7 mm. Very similar to Platycheirus and other Melanostoma species but with close inspection of some finer details can be identified with certainty. Adult males closely resemble Platycheirus clypeatus but lack the flattening or broadening of the front legs characteristic of most Platycheirus males. Females resemble female Melanostoma scalare sharing similar triangular tergite markings but have a shiny, black frons which separates them from M. scalare and most Platycheirus species.

Preferred habitat include grasslands and moorlands including those in hilly and mountainous regions. Adults can be found feeding on the pollen of grasses (Poaceae) and other wind-pollinated plants.

Little is known of its biology, However the larvae are suspected to be general predator of small insects in leaf litter.

Flight times in Britain and Ireland are from April to October with peaks in late May - early June and from July to August. [1][2][3][4][5][6]

References[edit]

  1. ^ Ball, Stuart; Morris, Roger (2013). Britain's Hoverflies: An Introduction to the Hoverflies of Britain. Woodstock, Oxfordshire: Princeton University Press. pp. 296pp. ISBN 978-0-691-15659-0. 
  2. ^ Ball, S.G.; Morris, R.K.A. (2000). Provisional atlas of British hoverflies (Diptera, Syrphidae). Monks Wood, UK: Biological Record Centre. pp. 167 pages. ISBN 1-870393-54-6. 
  3. ^ Morris, Roger, K. A. (1999). Hoverflies of Surrey. Surrey Wildlife Trust. p. 244. ISBN 0-9526065-3-4. 
  4. ^ Speight, M.C.D. (2011). "Species accounts of European Syrphidae (Diptera)". Syrph the Net, the database of European Syrphidae 65: 285pp. 
  5. ^ Stubbs, Alan E.; Falk, Steven J (1983). British Hoverflies: An Illustrated Identification Guide (2nd ed.). London: British Entomological and Natural History Society. pp. 253, xvpp. ISBN 1-899935-03-7. 
  6. ^ Van Veen, M.P. (2004). Hoverflies of Northwest Europe, Identification Keys to the Syrphidae (Hardback). Utrecht: KNNV Publishing. p. 254. ISBN 90-5011-199-8. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!