Overview

Comprehensive Description

General Description

Approximately 7 to 16 mm in length, black and yellow body. Eye bare, face yellow. Distinguishing between S. ribesii and S. vitripennis is quite difficult, however S. ribesii has the bm cell entirely covered with tiny hairs (i.e. trichose, see A on image) (Gilbert 1986). All specimens have tergites 3 and 4 with a yellow band rather than spots; these bands are usually complete but slightly divided in the middle in some specimens (see B on image), with this species generally showing a lot of variation in the shape of abdominal bands (Vockeroth 1992). Males: Frons usually completely dark, although it may be yellow on bottom one-fifth on some specimens. Hind femur either yellow or black on basal two-thirds. Females: Similar to males, although mid and hind femora only black right at base, with most specimens having a hind femur that is completely yellow (Vockeroth 1992).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Differential diagnosis

Vockeroth (1969) gave a genus diagnosis for Syrphus.

Small to medium sized, robust species with mesonotum yellowish- or greyish-pollinose laterally and tergites with transverse yellow fasciae or pairs of maculae.

Eye usually bare, rarely sparsely or densely pilose. Front and face of male rarely slightly swollen, in this case the face broad and with indistinct tubercle. Face usually entirely yellow, rarely with a very narrow brown median vitta. Basoflagellomere usually short oval and broadly rounded apically, rarely slightly elongate and subacute. Scutum shining or subshining, aeneous to black, sometimes with faint, dark, narrow median and submedian vittae; sides of scutum and all of pleura usually slightly but distinctly yellowish- or greenish-grey pollinose. Dorsal and venrtal katepisternal pile patches joined posteriorly by narrow band of hairs. Metasternum bare. Lower lobe of squama almost always with many long erect pale pile on at least posteromedian part of upper surface, these hairs few in number or absent only in one species from Patagonia. Metacoxa with tuft of pile at posteromedian apical angle. Abdomen oval, narrow to moderately broad, slightly convex dorsally, weakly margined from about middle of tergum 2 to apex of tergum 5 or 6. Tergum 2 with a pair of yellow maculae, terga 3 and 4 with sharply defined, often somewhat undulate, narrow or broad, entire or divided, bright yellow fasciae which mayor may not extend to lateral margins. Sterna yellow.

MALE Terminalia. Surstylus short, broad, curved slightly ventrad, bluntly rounded apically; inner surface with weak marginal flange dorsally and posteriorly except at apex. Sternite 9 with moderate emargination posteroventrally, with long, rather slender, slightly tapering lingula which is either subcylindrical or grooved on dorsal surface and is curved very slightly to strongly ventrad near its apex. Superior lobe long, broad, directed posterodorsad, strongly compressed, with many minute setae laterally; anteroventral angle with a short recurved hook, ventrolaterally and posterolaterally with a very low compressed submarginal flange which ends posterodorsally in a short projecting tooth. Aedeagal base subtriangular in profile, deeper and slightly compressed dorsally, projecting ventrad as a flat, depressed, apically truncate or apically rounded plate which almost always bears a small to moderately large, anteriorly directed, sub lateral or lateral tooth on each side near apex. Distal portion of aedeagus subtriangular or somewhat depressed in section, flattened posterodorsally and subcarinate anteroventrally, the apex only slightly weaker and slightly to strongly flared laterally and ventrally, with many minute pale spicules anteriorly.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Widespread throughout Canada, and from Alaska down to Mexico and Central America. It is also found in much of Europe, as well as Asia (Vockeroth 1992).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

S. ribesii ranges from Iceland and Fennoscandia south to Iberia and the Mediterranean; Canary Isles; from Ireland eastwards through most of Europe into Turkey, European parts of Russia and Afghanistan; from the Urals to the Pacific coast (Kuril Isles); Japan. In North America, from Alaska to New Brunswick, south to Mexico (Speight 2010; Thompson 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Nomenclature and Synonymy

Synonyms:

Syrphus nigrigena Enderlein, 1938: 209.

Syrphus himalayanus Nayar, 1968: 121.

Syrphus interruptus Ringdahl, 1930: 173.

Syrphus autumnalis Fluke, 1954: 3.

Syrphus bigelowi Curran, 1924: 288.

Syrphus similis Jones, 1917: 224.

Musca ribesii Linnaeus, 1758: 593.

Scaeva concava Say, 1823: 89.

Syrphus philadelphicus Macquart, 1842: 153.

Syrphus vittafrons Shannon, 1916: 202.

Syrphus beringi Violovitsh, 1975: 78.

Musca blandus Harris, 1780: 106.

Musca vacua Scopoli, 1763: 346.

Syrphus jezoensis Matsumura, 1917: 32.

Syrphus japonicus Matsumura, 1917: 31.

Syrphus moiwanus Matsumura, 1917: 33.

Syrphus yamahanensis Matsumura, 1917: 34.

Syrphus maculifer Matsumura, 1918: 29.

Syrphus teshikaganus Matsumura, 1918: 29.

Syrphus jonesii Fluke, 1949: 41.

Syrphus brevicinctus Kanervo, 1938: 155.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Technical Description

New description:

MALE.

Head: Face with distinct tubercle, gradually sloping dorsally, more abrupt ventrally, yellow, yellow pilose with black pile dorsolaterally, yellow pollinose laterally; gena yellow, yellow pilose; lunule yellow medially; frontal triangle yellow with a medial dark brown macula not reaching posterior margin, black pilose, yellow pollinose posteriorly; holoptic, eye bare; vertical triangle black, black pilose; antenna brown, basoflagellomere orange basally; occiput black, yellowish-grey pollinose, whitish-yellow pilose.

Thorax: Scutum black, yellow-bronze pollinose except anteriorly, with lateral yellow pollinose vitta, yellow pilose; postpronotum bare; scutellum yellow, black pilose, yellow pilose basally, subscutellar fringe complete with yellow pile. Pleuron black, densely yellow pollinose, yellow pilose; anterior anepisternum bare; metasternum bare; calypter yellow, ventral lobe with many long erect pile dorsally; plumula yellow; halter yellow; spiracular fringes yellow. Wing: Wing membrane hyaline, entirely microtrichose. Alula broad, microtrichose. Legs: Entirely yellow with pro- and mesofemora black on basal 1/4; metafemur brown to black on basal half; metatibia dark yellow, slightly arcuate; tarsi brown.

Abdomen: Slightly oval, terga 2, 3 and 4 vaguely margined. Dorsum mainly black, black pilose dorsally and laterally except 1st tergum yellow pilose and 2nd tergum yellow pilose on basal 1/2; tergum 1 black; tergum 2 black with 2 mesolateral round yellow maculae, extended forward laterally to anterolateral tergum margin (like “golf club” shaped spots); terga 3 and 4 black with anteromedial broad yellow fascia, with posterior margin sinuose, tergum 4 with yellow fascia on posterior margin; 5th tergum yellow with medial black macula; sterna mainly yellow, dark yellow posteriorly on terga 3 and 4, yellow pilose.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Citation

Syrphus ribesii (Linnaeus, 1758).

Linnaeus, C. (1758) Systema naturae... Ed. 10, Vol. 1. 824 pp. L. Salvii, Holmiae [= Stockholm].

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Looks Alike

Whether the enigmatic, European, female specimens referable to S. rectus Osten Sacken represent a distinct species or a variant of S. vitripennis is as yet unclear, but whatever they represent, using existing keys except those of Speight (1988a) and Goeldlin (1996) such specimens would be misdetermined as S. ribesii, since their legs are yellow as in female S. ribesii. They may easily be distinguished by the large areas bare of microtrichia on their wings, which are entirely covered in microtrichia in S. ribesii. Boyes et al (1971) show that over much of Europe there are two chromosome races of S. ribesii, as currently defined, one with 2n = 8, the other with 2n = 10. It is not known if these races have any taxonomic significance (Speight 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Variable; mixed forests, gardens, meadows, and fields (Laska and Stary 1980).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred environment by adults: anthropophilic, occurring in farmland, orchards, horticultural land, suburban gardens and parks, conifer plantations; also in most types of deciduous and coniferous forest (Speight 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

This species is highly migratory (Speight 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Larvae are aphidophagous and polyphagous, and feed on a wide range of aphid species. In North America, larvae have been recorded on several species of Aphis and Microsiphum, as well as on Pemphigus populicaulis, Cinara hottesi, C. carolina, and C. lasiocarpa (Vockeroth 1992).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Syrphus ribesii in Illinois

Syrphus ribesii Linnaeus: Syrphidae, Diptera
(observations are from Robertson, Graenicher, and Larson & Barrett)

Aceraceae: Acer saccharum [oozing sap] (Rb); Anacardiaceae: Rhus aromatica [pist sn] (Rb), Rhus glabra [stam sn] (Rb); Apiaceae: Chaerophyllum procumbens sn (Rb), Cryptotaenia canadensis sn (Rb), Heracleum maximum sn (Rb), Osmorhiza longistylis sn (Rb), Oxypolis rigidior sn (Rb), Pastinaca sativa sn (Rb), Perideridia americana sn (Rb), Sium suave sn (Rb), Taenidia integerrima sn (Rb), Zizia aurea sn (Rb); Asteraceae: Achillea millefolium sn (Rb), Ageratina altissima sn/fp (Rb, Gr), Anthemis cotula sn/fp (Gr), Arctium lappa sn/fp (Gr), Aster drummondii sn/fp (Gr), Aster laevis sn/fp (Gr), Aster lanceolatus sn (Rb), Aster lateriflorus sn/fp (Gr), Aster novae-angliae sn/fp (Gr), Aster pilosus sn fq (Rb), Aster prenanthoides sn/fp (Gr), Aster sagittifolius sn (Rb), Aster salicifolius sn (Rb), Cirsium arvense sn/fp (Gr), Coreopsis palmata sn (Rb), Erigeron philadelphicus sn/fp (Gr), Eupatorium perfoliatum sn (Rb), Helianthus grosseserratus sn (Rb), Helianthus strumosus sn/fp (Gr), Leucanthemum vulgare sn/fp (Gr), Rudbeckia laciniata fp np (Rb), Solidago canadensis sn/fp (Gr), Solidago juncea sn/fp (Gr), Verbesina alternifolia sn (Rb); Berberidaceae: Jeffersonia diphylla exp (Gr); Brassicaceae: Arabis shortii fp (Rb); Caprifoliaceae: Sambucus canadensis fp fq (Rb); Caryophyllaceae: Stellaria media sn (Rb); Celastraceae: Euonymus atropurpureus sn/fp (Rb, Gr); Commelinaceae: Tradescantia virginiensis fp np (Rb); Cucurbitaceae: Echinocystis lobata sn (Rb); Ebenaceae: Diospyros virginiana [stam fp np] (Rb); Hamamelidaceae: Hamamelis virginiana sn/fp (Gr); Lamiaceae: Leonurus cardiaca fp np (Rb), Stachys palustris fp np (Rb); Lauraceae: Sassafras albidum sn (Rb); Melastomataceae: Rhexia virginica fsp np (LBt); Nelumbonaceae: Nelumbo lutea fp (Rb); Portulacaceae: Claytonia virginica sn (Rb); Ranunculaceae: Enemion biternatum fp/exp (Rb), Ranunculus septentrionalis sn (Rb); Rhamnaceae: Rhamnus lanceolata sn (Rb); Rosaceae: Aruncus dioicus [pist sn] (Rb), Prunus serotina [flwr sn] (Rb), Rubus allegheniensis fp np (Rb); Salicaceae: Salix discolor [unsp sn/fp] (Gr), Salix nigra [stam sn] (Rb); Smilacaceae: Smilax tamnoides hispida sn/fp (Gr); Solanaceae: Datura stramonium tatula fp np (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasitoid
larva of Syrphoctonus tarsatorius is parasitoid of aphidivorous larva of Syrphus ribesii

Animal / parasitoid
larva of Syrphophilus tricinctorius is parasitoid of egg of Syrphus ribesii
Other: major host/prey

Animal / predator
larva of Syrphus ribesii is predator of Aphidoidea

Plant / associate
larva of Syrphus ribesii is associated with aphid-infested Acer pseudoplatanus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults visits a wide range of yellow, white, pink and blue flowers, including composites and umbellifers and the flowers of many trees and shrubs (see extended list in de Buck, 1990).

Larvae of S. ribesii have been reported feeding on Adelgidae, Aphididae, larvae and eggs of Melasoma aenea (Coleoptera) and larvae of Lepidoptera (see a full list of species in Rojo et al. 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Adults inhabitat gardens, tracksides, clearings, hedgerows etc.; flies up to 5 m from ground; males hover at 2-5 m (Speight 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adult flight ranges between April and October in Canada.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Flight period for European specimens is from April to mid November (plus March in southern Europe), with peaks in May and August (Speight 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Syrphus ribesii is oligovoltine in England, with either two or three generations per year, and overwinters as a cold-tolerant larva (Sadeghi and Gilbert 2000a). However, it has also been reported to migrate in large numbers to the Mediterranean to overwinter (Gilbert 1986). It is a common and voracious predator, and can have a significant effect on the natural regulation of aphid populations. Males can be heard to make an audible noise with their wings as they vibrate them rapidly to warm up their thoracic muscles for flight; this is presumably to maximize the chances of catching a female, as mating occurs mid-flight and lasts as little as two seconds (Gilbert 1986). After pupation, emerged adult females are able to oviposit 7 to 8 days post-eclosion (Sadeghi and Gilbert 2000b). Much work has been done on the oviposition preference of the females of this species, with females showing a strong preference to oviposit near sycamore aphids, rose aphids, and pea aphids when given a choice of eight species (Sadeghi and Gilbert 2000b). Many parasitoids of S. ribesii are also known, including (amongst many families) members of the Braconidae, Chalcididae, Proctotrupidae, Encyrtidae, and Ichneumonidae. In particular, the Ichnuemonid Diplazon laetatorius is a common enemy, and S. ribesii larvae have evolved many defences against them. The remain still when they detect parasitiod antennal tapping, and emit a sticky oral substance if an ovipositor is inserted. Finally, they will assume a crescent shape and roll over if an attack persists (Rotheray 1981).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Larva of S. ribesii was described and figured by Dusek and Laska (1964); it is aphid feeding on various herbaceous plants (e.g. Carduus, Eryngium, Sonchus, umbellifers), including some crops (Beta, Triticum, Vicia, Zea), bushes (e.g. Rubus spp.) and shrubs. The larva of this species apparently occurs in a number of distinct colour forms, as illustrated in colour by Rotheray (1993) and Bartsch et al (2009a). Egg: Chandler (1968). The morphology of the chorion of the egg is figured by Kuznetzov (1988). Laboratory culture detailed by Bombosch (1957).

Egg (from Chandler 1968).

White, greying slightly on development; mean length 957 µ (n = 230, range 820-1110 µ), mean width 427 µ; strongly tapering towards one end; marked surface projections dorsally and laterally. Chorionic sculpturing: dorsally, projections mushroom-shaped, neck wider than long, appearance of units dendritic, ramification with extensive contact between branches of neighbouring units; ventrally, sculpturing of large dots and rods not aggregated into discrete groups. Ecological notes: Common; eggs found from May to October; wide host acceptance range; eggs laid singly.

Third instar larva (from Dixon 1960).

Length 9.0-11.5 mm., width 2.5 mm., height 2 mm. ; from a fine cream line on either side of heart line five segmentally arranged postero-laterally directed oval groups of white to bright yellow adipose tissue; adipose tissue occasionally entirely pink in some specimens, gut contents appearing black beneath adipose tissue; subcylindrical, tapering anteriorly, cuspidate posteriorly; felashy projections and prominences absent ; integumental vestiture restricted to a few fine dark hairs round mouth; body papillose; segmental ornamentation typical. Posterior respiratory process: half as long as broad; smooth; sclerotized; constricted one third length from base; circular plates round; dorsal spurs prominent and broadly triangular in side view; interspiracular ornamentation consisting of four pairs of well-developed nodules; spiracles straight, equidistant, mounted on dark carinae; I and 111 slightly less than 180º apart; a fringe of hairs present on inner border of spiracles.

Source of material: collected from trees, shrubs and herbs at Silwood Park from June to October.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Phylogeny

Dusek and Laska (1967) placed Syrphus in their tribe Syrphini, with Leucozona and Ischyrosyrphus as sister groups. Vockeroth (1969) considered it also Syrphini, and following his disposition within his work, Syrphus was somewhat related with Epistrophe and Epistrophella.

Rotheray and Gilbert (1989) recovered Syrphus as sister group of many genera, with Meliscaeva as sister group of these genera plus Syrphus. Rotheray and Gilbert (1999) recovered Syrphus in a different position: Syrphus was resolved in a polytomy with Fagisyrphus, Parasyrphus and Melangyna as siter group of many genera, being Meliscaeva the sister group of these genera plus Syrphus.

Ståhls et al. (2003) recovered Syrphus as related with Chrysotoxum, but their taxon sampling was not done thinking on Syrphinae. The same result was obtained by Hippa and Ståhls (2005). Mengual et al. (2008) resolved Syrphus as sister group of Parasyrphus, and both as sister group of Eupeodes and Scaeva clade.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syrphus ribesii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GACATTATATTTTTTATTTGGAACTTGAGCTGGTATAGTAGGAACATCTTTAAGTGTATTAATTCGTGCAGAGCTTGGACACCCAGGTGCTTTAATTGGGGATGACCAAATTTATAATGTTATTGTAACTGCACATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTATTACCCCCTTCTTTAACACTTTTATTAGTAAGAAGAATAGTTGAAAATGGAGCTGGAACAGGTTGAACAGTTTATCCTCCTCTTTCTGCTAGTATTGCACATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATATCTTCAATTTTAGGAGCAGTAAATTTTATTACAACAGTAATTAATATACGTTCTAATGGTCTTACATATGATCGAATACCTTTATTTGTGTGATCAGTAGTGATTACAGCTTTATTACTACTTTTATCTTTACCAGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACCTCATTTTTTGATCCAGCAGGAGGAGGNGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Syrphus ribesii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 120
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Widespread and common, not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Syrphus ribesii

Syrphus ribesii is a very common European species of hoverfly. Its larva feed on aphids [1]

References[edit]

  1. ^ Stubbs, Alan E. and Falk, Steven J. (1983). British Hoverflies: An Illustrated Identification Guide. British Entomological & Natural History Society. pp. 253, xvpp. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!