Ecology

Associations

Flowering Plants Visited by Syrphus torvus in Illinois

Syrphus torvus Osten Sacken: Syrphidae, Diptera
(observations are from Robertson, Graenicher, Anderson & Hill, Schemske et al., and Small)

Apiaceae: Chaerophyllum procumbens sn (Rb), Heracleum maximum sn (Rb); Aquifoliaceae: Nemopanthus mucronatus (Sm); Asteraceae: Aster drummondii sn/fp (Gr), Aster laevis sn/fp (Gr), Aster lateriflorus sn (Rb); Brassicaceae: Arabis shortii sn (Rb), Dentaria laciniata (Shm); Hamamelidaceae: Hamamelis virginiana sn/fp (AH); Lauraceae: Sassafras albidum sn (Rb); Polygonaceae: Persicaria pensylvanica sn (Rb); Portulacaceae: Claytonia virginica sn (Rb, Shm); Ranunculaceae: Enemion biternatum fp/exp (Shm), Ranunculus septentrionalis sn (Rb); Rosaceae: Aronia melanocarpa fq (Sm), Crataegus intricata sn (Rb), Prunus americana sn (Rb); Salicaceae: Salix amygdaloides [pist sn] (Rb), Salix rigida [stam sn] (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plant / associate
larva of Syrphus torvus is associated with aphid-infested Acer pseudoplatanus

Animal / predator
larva of Syrphus torvus is predator of Aphidoidea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syrphus torvus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAACTTGAGCTGGAATAGTAGGAACATCATTAAGTGTATTAATTCGTGCAGAACTTGGTCATCCAGGAGCTTTAATTGGAGATGACCAAATTTATAATGTTATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCTCGTATAAATAATATAAGTTTTTGACTATTACCTCCTTCTTTAACTCTTTTATTAGTAAGAAGAATAGTTGAAAACGGAGCTGGAACAGGTTGAACAGTTTACCCTCCTCTTTCTGCTAGTATTGCACATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATATCTTCAATTTTAGGAGCAGTAAATTTTATTACAACAGTAATTAATATACGTTCTAGTGGACTTACTTATGATCGAATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTACTTCTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTCTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Syrphus torvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Syrphus torvus

Syrphus torvus is a common European species of hoverfly. Its larvae feed on aphids [1]

References

  1. ^ Stubbs, Alan E. and Falk, Steven J. (1983). British Hoverflies: An Illustrated Identification Guide. British Entomological & Natural History Society. p. 233, xvpp.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!