Overview

Comprehensive Description

General Description

Approximately 7 to 15 mm in length, black and yellow body, face yellow. Although S. torvus looks superficially very much like both S. ribesii and S. vitripennis (refer to descriptions for these two species), its distinctive characteristic is that both males and females have hairy eyes. The hairs on the male eyes are denser and longer than those on the female eyes, however this characteristic is quite clear for both sexes (under a microscope). As well, the yellow bands of tergites 3 and 4 are complete, and both sexes have a hind femur that is black for approximately the basal three-quarters (Vockeroth 1992).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Syrphus torvus is widespread throughout Canada, and from Alaska down to California and Mississippi. It is also found in much of Europe (including as far north as Svalbard), as well as Asia, with records from Siberia and Nepal (Vockeroth 1992).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Boreal regions, mixed forest, parks, gardens.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Syrphus torvus is entirely aphidophagous, and the larvae have been recorded on the aphids Cinara carolina, and on Euceraphus spp. (Vockeroth 1992). Adults feed on pollen and nectar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Syrphus torvus in Illinois

Syrphus torvus Osten Sacken: Syrphidae, Diptera
(observations are from Robertson, Graenicher, Anderson & Hill, Schemske et al., and Small)

Apiaceae: Chaerophyllum procumbens sn (Rb), Heracleum maximum sn (Rb); Aquifoliaceae: Nemopanthus mucronatus (Sm); Asteraceae: Aster drummondii sn/fp (Gr), Aster laevis sn/fp (Gr), Aster lateriflorus sn (Rb); Brassicaceae: Arabis shortii sn (Rb), Dentaria laciniata (Shm); Hamamelidaceae: Hamamelis virginiana sn/fp (AH); Lauraceae: Sassafras albidum sn (Rb); Polygonaceae: Persicaria pensylvanica sn (Rb); Portulacaceae: Claytonia virginica sn (Rb, Shm); Ranunculaceae: Enemion biternatum fp/exp (Shm), Ranunculus septentrionalis sn (Rb); Rosaceae: Aronia melanocarpa fq (Sm), Crataegus intricata sn (Rb), Prunus americana sn (Rb); Salicaceae: Salix amygdaloides [pist sn] (Rb), Salix rigida [stam sn] (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Plant / associate
larva of Syrphus torvus is associated with aphid-infested Acer pseudoplatanus

Animal / predator
larva of Syrphus torvus is predator of Aphidoidea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adult flight period is quite extensive, occurring from April to November.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Probably multivoltine, with the larva as the overwintering stage. Syrphus torvus is aphidophagous and polyphagous, seeming to prefer shrubs and trees to herbs (Schneider 1969). Sendstad (1976) reported that they seem to prefer the vegetation-rich slopes beneath bird cliffs in Spitsbergen, Svalbard.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syrphus torvus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAACTTGAGCTGGAATAGTAGGAACATCATTAAGTGTATTAATTCGTGCAGAACTTGGTCATCCAGGAGCTTTAATTGGAGATGACCAAATTTATAATGTTATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCTCGTATAAATAATATAAGTTTTTGACTATTACCTCCTTCTTTAACTCTTTTATTAGTAAGAAGAATAGTTGAAAACGGAGCTGGAACAGGTTGAACAGTTTACCCTCCTCTTTCTGCTAGTATTGCACATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATATCTTCAATTTTAGGAGCAGTAAATTTTATTACAACAGTAATTAATATACGTTCTAGTGGACTTACTTATGATCGAATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTACTTCTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTCTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Syrphus torvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Widespread, not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Syrphus torvus

Syrphus torvus is a common species of hoverfly found in Europe, Asia and North America. The adults feed on pollen and nectar but the larvae feed on aphids.

Description[edit]

Syrphus torvus is a medium-sized hoverfly that somewhat resembles a wasp, with adults measuring 10 to 13 mm (0.4 to 0.5 in). The head is broad and the large brown compound eyes have hairy surfaces, more obvious in males than females. The eyes are nearly touching in males but are more widely separated in females. The face and short antennae are yellow. The thorax is black, the legs yellow and black, and the single pair of wings is translucent with dark veining. The abdomen is oblong and slightly flattened. It is fringed with short yellow hairs and striped in yellow and black, the first yellow stripe being divided by a central black bar.[1]

Distribution and habitat[edit]

Syrphus torvus is a common species and is found in the Palearctic ecozone including Europe, Asia and North America. It is often found in woodland or near the verges of woods.[1] Large numbers of hoverflies of this species and of Metasyrphus sp. have been observed on Mount McKinley in the Rocky Mountains at altitudes of 5,000 metres (16,000 ft) at the head of the Kahiltna Glacier.[2]

Behaviour[edit]

Syrphus torvus is on the wing from spring to autumn. It is a migratory species. Adults feed on pollen and nectar and are particularly attracted to yellow and white flowers. The larvae feed on aphids and the insect overwinters as larvae.[1][3]

References[edit]

  1. ^ a b c "Hoverflies (Syrphidae)". The Garden Safari. Retrieved 2014-12-03. 
  2. ^ Edwards, J. S. (1987). "Arthropods of Alpine Aeolian Ecosystems". Entomology 32: 163–179. doi:10.1146/annurev.en.32.010187.001115. 
  3. ^ Stubbs, Alan E.; Falk, Steven J. (1983). British Hoverflies: An Illustrated Identification Guide. British Entomological & Natural History Society. p. 233, xvpp. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!