Overview

Comprehensive Description

Description of Syrphus luniger

Eupeodes luniger is a moderate sized (average of 8mm length) Syrphid hoverfly with characteristic wasp-like yellow markings on the abdomen. In the case of E. Luniger these are obviously comma shaped and usually do not meet at the centre line of the abdomen, although in this variable species some individuals show markings that do meet and form spectacle shaped yellow patches. These markings do not reach the lateral edges.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Jerry

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

Description of Syrphus luniger

In terms of the abdomen pattern this species is most similar to Syrphus corollae, Scaeva pyrastri, Scaeva selenitica and Scaeva albamaculata.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Jerry

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Description of Syrphus luniger

Syrphus luniger frequents habitats such as roadside verges, meadows, gardens, heaths and similar
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Jerry

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasitoid
larva of Enizemum ornatum is parasitoid of larva of Eupeodes luniger

Animal / predator
larva of Eupeodes luniger is predator of Aphidoidea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Syrphus luniger preys on:
Acyrthosiphon spartii
Aphis sarathamni

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupeodes luniger

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TACATTATATTTTTTATTTGGTACTTGAGCAGGTATAGTAGGTACTTCTTTAAGTGTATTAATTCGTGCAGAACTTGGTCATCCAGGAGCTTTAATTGGTGATGATCAAATTTATAATGTAATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATACTTGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGTTTTTGATTATTACCTCCATCTTTAACTCTTTTATTAGTAAGAAGAATAGTTGAAAATGGAGCTGGAACTGGTTGAACAGTTTACCCTCCACTTTCTGCTAGTATTGCACATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATCTAGCTGGTATATCTTCAATCTTAGGAGCTGTAAATTTTATTACTACAGTAATTAATATACGATCTAATGGAATTTCTTATGATCGTATACCTTTATTTGTATGATCAGTAGTAATTACTGCTTTATTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGGAATTTAAATACATCATTCTTTGACCCAGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eupeodes luniger

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eupeodes luniger

Eupeodes luniger is a common European species of hoverfly.[1][2][3][4]

It is characterized by hook-shaped markings along the center of its abdomen.[5]

References[edit]

  1. ^ Ball, S.G.; Morris, R.K.A. (2000). Provisional atlas of British hoverflies (Diptera, Syrphidae). Monks Wood, UK: Biological Record Centre. pp. 167 pages. ISBN 1-870393-54-6. 
  2. ^ Morris, Roger, K. A. (1999). Hoverflies of Surrey. Surrey Wildlife Trust. p. 244. ISBN 0-9526065-3-4. 
  3. ^ Stubbs, Alan E. and Falk, Steven J. (1983). British Hoverflies: An Illustrated Identification Guide. British Entomological & Natural History Society. p. 253, xvpp. 
  4. ^ Van Veen, M.P. (2004). Hoverflies of Northwest Europe, Identification Keys to the Syrphidae (Hardback). Utrecht: KNNV Publishing. p. 254. ISBN 90-5011-199-8. 
  5. ^ A. Dale. "A Nature Observer′s Scrapbook : Hoverflies". Retrieved 2010-06-17. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!