Ecology

Associations

Flowering Plants Visited by Rhingia nasica in Illinois

Rhingia nasica Say: Syrphidae, Diptera
(observations are from Robertson, Graenicher, and Stoutamire)

Alismataceae: Sagittaria latifolia [stam sn] (Rb); Apiaceae: Osmorhiza longistylis sn (Rb); Asteraceae: Ageratina altissima sn (Rb), Erigeron philadelphicus sn/fp (Gr), Polymnia canadensis (Gr); Balsaminaceae: Impatiens capensis sn np (Gr), Impatiens pallida sn fp np (Rb); Berberidaceae: Caulophyllum thalictroides sn (Rb); Boraginaceae: Mertensia virginica sn fp (Rb); Hydrophyllaceae: Ellisia nyctelea sn (Rb), Hydrophyllum appendiculatum sn fp fq (Rb), Hydrophyllum virginianum fp np (Rb); Lamiaceae: Glechoma hederacea sn (Rb), Nepeta cataria sn (Rb), Scutellaria ovata bracteata fp np (Rb); Orchidaceae: Cypripedium acaule exp fq np (Stm); Polemoniaceae: Polemonium reptans sn fp (Rb); Portulacaceae: Claytonia virginica sn (Rb); Rosaceae: Rosa carolina fp np (Rb); Solanaceae: Datura stramonium tatula fp np (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhingia nasica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTTTATTTGGAACATGAGCTGGAATAGTAGGTACTTCATTAAGAATTTTAATTCGTGCTGAATTAGGGCACCCCGGAGCATTAATTGGTAATGATCAAATTTATAATGTAATTGTAACTGCACATGCTTTCGTAATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAACTTTATTATTAGTAAGAAGTATGGTAGAAAATGGAGCTGGTACAGGATGAACAGTTTACCCTCCACTTTCAGCTAATATTGCTCATAGTGGAGCTTCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGAATATCCTCAATTTTAGGAGCAGTAAATTTTATTACCACAGTAATTAATATACGTTCAGCAGGAATTTCTTATGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACTGCTTTATTACTTTTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATCTAAATACTTCTTTTTTTGACCCTGCTGGAGGAGGGGATCCTGTTTTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhingia nasica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!