Overview

Brief Summary

The drone fly (Eristalis tenax) is a hoverfly native to Europe, and is now established worldwide. The drone fly is so named because it is thought to mimic the European honey bee drone (Apis mellifera), with a black and yellow striped body and similar flight patterns. The adult fly eats pollen and is a common visitor to flowers, especially yellow ones, making it a significant beneficial pollinator. Two or three generations of drone flies occur each year, with the females laying about 20 eggs in masses next to fouled water or decaying organic material, such as in manure lagoons or holding pits in livestock areas. The aquatic drone fly larvae are a cylindrical shape, about 2 cms long and notable for their long “tail”, a specialized respiratory structure several times the length of their body, which functions as a breathing straw to allow the larvae to breathe air from the surface while filter feeding in anoxic conditions. The tail gives these larvae their common name: rat tailed maggots. The larvae migrate onto drier land to pupate, usually just under the ground, and the pupae retain the tail, locked into a loop over the body. In large numbers, migrating larvae sometimes become a nuisance in that they contaminate livestock feed. Rare cases of accidental, benign, and often asymptomatic myiasis (inhabitation of a living vertebrate host) have been reported for this insect, thought to occur by ingestion of food or water contaminated with larvae. These cases are easily treated.

(Aguilera, Cid and Regueiro 1999; Grissell, and Fasulo 2010; Ilse 1949; Wikipedia 2011)

  • Aguilera, A., A. Cid, and B. J. Regueiro, 1999. Intestinal Myiasis Caused by Eristalis tenax. J Clin Microbiol. 1999 September; 37(9): 3082.
  • Golding YC, Ennos AR, Edmunds M. 2001. Similarity in flight behaviour between the honeybee Apis mellifera (Hymenoptera: Apidae) and its presumed mimic, the dronefly Eristalis tenax (Diptera: Syrphidae). The Journal of Experimental Biology 204: 139-145.
  • Grissell, E.E. and T. R. Fasulo, 2010. Featured creatures: Vespula and Dolichovespula spp. (Insecta: Hymenoptera: Vespidae). University of Florida, Publication Number: EENY-445. Retrieved October 18, 2011 from http://edis.ifas.ufl.edu/in809">http://edis.ifas.ufl.edu/in809">http://edis.ifas.ufl.edu/in809
  • Ilse D. 1949. Colour discrimination in the drone fly Eristalis tenax. Nature 163: 255-256.
  • Wikipedia, The Free Encyclopedia. 26 March, 2011. "Eristalis tenax". Retrieved October 18, 2011 from http://en.wikipedia.org/w/index.php?title=Eristalis_tenax&oldid=420874325">http://en.wikipedia.org/w/index.php?title=Eristalis_tenax&oldid=420874325">http://en.wikipedia.org/w/index.php?title=Eristalis_tenax&oldid=420874325
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

This is a very wide-spread species and it is considered cosmopolitian. E. tenax is known from Palaearctic, Nearctic, Australian, Afrotropical, Oriental and Neotropical Regions, and it is also present in some major islands like Hawaii, Bonins, New Zealand, Australia, and Easter Island.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Citation

Eristalis (Eristalis) tenax (Linnaeus, 1758).

Linnaeus, C. (1758) Systema naturae... Ed. 10, Vol. 1. 824 pp. L. Salvii, Holmiae [= Stockholm].

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Eristalis tenax in Illinois

Eristalis tenax Linnaeus: Syrphidae, Diptera
(observations are from Robertson, Graenicher, Reed, Conger, and Wist)

Acanthaceae: Justicia americana sn fp (Rb); Anacardiaceae: Rhus glabra [stam sn] (Rb); Apiaceae: Cicuta maculata sn (Rb), Eryngium yuccifolium sn (Rb), Perideridia americana sn (Rb), Sium suave sn (Rb); Asteraceae: Achillea millefolium sn/fp (Rb, Gr), Ageratina altissima sn/fp (Gr), Arctium lappa sn/fp (Gr), Arctium minus sn (Rb), Arnoglossum muhlenbergii sn/fp (Gr), Aster drummondii sn/fp (Gr), Aster ericoides sn/fp (Re), Aster laevis sn/fp (Gr), Aster lanceolatus sn/fp (Rb, Gr), Aster lateriflorus sn/fp (Gr), Aster macrophyllus sn/fp (Gr), Aster novae-angliae sn fp (Rb, Gr), Aster oolentangiensis sn/fp (Re), Aster pilosus sn (Rb), Aster prenanthoides sn/fp (Gr), Aster puniceus sn/fp (Gr), Aster salicifolius fp (Rb), Cirsium altissimum fp (Gr), Cirsium arvense sn/fp (Gr), Conyza canadensis sn (Rb), Coreopsis palmata sn (Rb), Echinacea angustifolia (Ws), Eupatoriadelphus purpureus sn/fp (Gr), Eupatorium perfoliatum sn/fp (Gr), Eupatorium serotinum sn (Rb), Helenium autumnale sn/fp (Gr), Helianthus giganteus sn/fp (Gr), Helianthus grosseserratus sn (Rb), Helianthus pauciflorus sn/fp (Re), Helianthus strumosus sn/fp (Gr), Helianthus tuberosus sn fp (Rb, Re), Krigia biflora sn (Rb), Leucanthemum vulgare sn/fp (Gr), Liatris aspera sn/fp (Re), Liatris pycnostachya sn (Rb), Liatris spicata fp (Gr), Oligoneuron rigidum sn/fp (Re), Ratibida pinnata sn/fp (Gr), Rudbeckia hirta sn/fp (Gr), Silphium perfoliatum sn (Rb), Solidago juncea sn/fp (Gr); Caprifoliaceae: Sambucus canadensis fp (Rb), Symphoricarpos orbiculatus sn (Rb); Caryophyllaceae: Stellaria media sn (Rb); Commelinaceae: Tradescantia virginiensis fp np (Rb); Fabaceae: Dalea purpurea sn/fp (Re); Hamamelidaceae: Hamamelis virginiana sn/fp (Gr); Hydrangeaceae: Hydrangea arborescens sn fp (Rb); Lamiaceae: Nepeta cataria sn (Rb), Pycnanthemum pilosum sn (Rb), Pycnanthemum tenuifolium sn fq (Rb), Pycnanthemum virginianum sn (Rb), Teucrium canadense sn/fp (Cng); Parnassiaceae: Parnassia glauca sn/fp (Gr); Polygonaceae: Persicaria pensylvanica sn (Rb); Rubiaceae: Cephalanthus occidentalis sn fq (Rb); Salicaceae: Salix discolor [unsp sn/fp] (Gr); Scrophulariaceae: Veronicastrum virginicum sn fp (Rb); Verbenaceae: Verbena stricta sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Hairs prevent entry of water: rat-tailed maggot
 

The breathing tubes of rat-tailed maggots block water from entering via hydrophobic hairs.

   
  "Some diptera (Syrphidae or red-tailed maggots [rat-tailed maggots]) and Ephydridae (shore flies) have a pair of posterior, telescopic breathing tubes that open in spiracles with hydrophobic hairs that prevent water from entering." (van der Valk 2006:49)
  Learn more about this functional adaptation.
  • van der Valk, A. 2006. The Biology of Freshwater Wetlands. Oxford: Oxford University Press. 173 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Eristalis tenax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 63
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eristalis tenax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATTACCTCCTTCTTTAACATTATTATTAGTAAGAAGTATAGTAGAAAATGGAGCTGGAACAGGATGAACTGTATACCCACCTTTATCAAGTAACATTGCACACGGAGGAGCCTCAGTTGATTTA---GCAATTTTTTCACTTCATTTATCTGGTATATCATCTATTTTAGGTGCAGTAAATTTCATTACAACTATTATTAATATACGGTCAACAGGAATTACATATGATCGAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTACTACTACTTCTTTCCCTACCAGTTTTAGCAGGA---GCAATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATACCAACATTTATTTTGATTCTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCCCATATTATTAGACAAGAATGTGGAAAAAAA---GAAACATTTGGATCTTTAGGAATAATTTATGCTATACTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTTGGAATAGACGTTGATACTCGAGCTTACTTTACATCAGCTACAATAATTATTGCTATTCCAACAGGAATTAAAATTTTCAGTTGATTA---GCAACTCTACACGGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eristalis tenax

Eristalis tenax is a European hoverfly, also known as the drone fly (or "dronefly"). It has been introduced into North America and is widely established.

Overview[edit]

The larva of E. tenax is a rat-tailed maggot. It lives in drainage ditches, pools around manure piles, sewage, and similar places containing water badly polluted with organic matter.[2] The larva likely feeds on the abundant bacteria living in these places.

When fully grown, the larva creeps out into drier habitats and seeks a suitable place to pupate. In doing so it sometimes enters buildings, especially barns and basements on farms. The pupa is 10–12 mm long, grey-brown, oval, and retains the long tail; it looks like a tiny mouse.

The adult fly that emerges from the pupa is harmless. It looks somewhat like a drone honey bee, and likely gains some degree of protection from this resemblance to a stinging insect. The adults are called drone flies because of this resemblance. Like other hover flies, they are common visitors to flowers, especially in late summer and autumn, and can be significant pollinators.

In its natural habitat, E. tenax is more of a curiosity than a problem, and the adults are beneficial pollinators.

Drone flies mating on a daisy inflorescence.

Identification[edit]

Large (wingspan 15mm), stocky, bee mimic. Eyes are marbled in black. Males have hovering displays.

Drone fly on ragwort, Jacobaea vulgarise

Diet[edit]

Adults feed on flowers, especially those of carrot and fennel.

Infection[edit]

There have occasionally been documented cases of human intestinal Myiasis of the rat-tailed maggot (larva of Eristalis tenax). Infection can be asymptomatic (no symptoms) or can manifest as symptoms ranging from abdominal pain, nausea and vomiting, to anal pruritus. Infection can be caused by ingestion of contaminated food or water but doubts have been expressed that accidentally ingested fly larvae could survive in the gastrointestinal tract. Zumpt proposed an alternative called "rectal myiasis". Flies, attracted to feces, may deposit their eggs or larvae near or into the anus, and the larvae then penetrate further into the rectum. They can survive feeding on feces at this site, as long as the breathing tube reaches towards the anus.[2][3]


References[edit]

  1. ^ Stubbs, Alan E. and Falk, Steven J. (1983). British Hoverflies: An Illustrated Identification Guide. British Entomological & Natural History Society. p. 253, xvpp. ISBN 0-9502891-4-0. 
  2. ^ a b Aguilera, A; Cid, A; Regueiro, BJ; Prieto, JM; Noya, M (1999). "Intestinal Myiasis Caused by Eristalis tenax". Journal of Clinical Microbiology 37 (9): 3082. PMC 85471. PMID 10475752. 
  3. ^ Phillip B. Whish-Wilson (2000). "A possible case of intestinal myiasis due to Eristalis tenax". Medical Journal of Australia. Retrieved January 13, 2008. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!