Overview

Distribution

This species is becoming cosmopolitan; known from most of the Palaearctic, including North Africa, most of North America, South America and the Oriental region. But records from the Afrotropical region are apparently erroneous (Speight 2010).

In the Nearctic Region, Syritta pipiens is known from British Columbia to Newfoundland, south to California and Florida, and Mexico (Thompson 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Citation

Syritta pipiens (Linnaeus, 1758).

Linnaeus, C. (1758) Systema naturae... Ed. 10, Vol. 1. 824 pp. L. Salvii, Holmiae [= Stockholm].

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Adults' preferred environment: wetland; fen, edges of bogs and along the margin of almost any freshwater body, including lakes, ponds, ditches, canals, brooks and rivers; anthropophilic, occurring in most sorts of farmland, suburban gardens and urban parks (Speight 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Syritta pipiens in Illinois

Syritta pipiens Linnaeus: Syrphidae, Diptera
(observations are from Robertson, Graenicher, Reed, Larson & Barrett, Barrett & Helenurm, Conger, Small, and Krannitz & Maun)

Acanthaceae: Justicia americana sn (Rb, Cng); Alismataceae: Alisma plantago-aquatica sn (Rb), Sagittaria latifolia [stam sn] [pist sn] (Rb); Anacardiaceae: Rhus copallina [pist sn fq] (Rb), Rhus glabra [pist sn] (Rb); Apiaceae: Cicuta maculata sn fq (Rb), Cryptotaenia canadensis sn fq (Rb), Erigenia bulbosa sn (Rb), Eryngium yuccifolium sn (Rb), Heracleum maximum sn (Rb), Osmorhiza longistylis sn fq (Rb), Oxypolis rigidior sn (Rb), Pastinaca sativa sn fq (Rb), Perideridia americana sn fq (Rb), Sium suave sn (Rb), Taenidia integerrima sn fq (Rb), Thaspium trifoliatum flavum sn (Rb), Zizia aurea sn (Rb); Asclepiadaceae: Asclepias sullivanti dead np (Rb), Asclepias syriaca [plpr sn] (Rb), Asclepias verticillata [plpr sn] (Rb); Asteraceae: Achillea millefolium sn/fp (Rb, Gr), Ageratina altissima sn/fp (Gr), Anthemis cotula sn/fp (Gr), Arctium lappa sn/fp (Gr), Arnoglossum muhlenbergii sn/fp (Rb, Gr), Aster drummondii sn/fp (Gr), Aster ericoides sn/fp (Rb, Re), Aster furcatus sn/fp (Gr), Aster laevis sn/fp (Gr), Aster lanceolatus sn/fp (Rb, Gr), Aster lateriflorus sn/fp (Gr), Aster macrophyllus sn/fp (Gr), Aster novae-angliae sn/fp (Gr), Aster pilosus sn fq (Rb), Aster puniceus sn/fp (Gr), Aster salicifolius sn (Rb), Aster turbinellus sn (Rb), Bidens bipinnata sn (Rb), Boltonia asterioides sn fp fq (Rb), Coreopsis tripteris sn (Rb), Conyza canadensis sn/fp (Rb, Gr), Erigeron annuus sn/fp (Gr), Erigeron philadelphicus sn/fp (Gr), Erigeron strigosus sn (Rb), Eupatorium altissimum sn (Rb), Eupatorium perfoliatum sn/fp (Gr), Euthamia graminifolia sn/fp (Gr), Helenium autumnale sn/fp (Gr), Helianthus annuus fp np (Rb), Helianthus strumosus sn/fp (Gr), Leucanthemum vulgare sn/fp (Rb, Gr), Oligoneuron rigidum sn (Rb), Parthenium integrifolium sn (Rb), Pseudognaphalium obtusifolium sn (Rb), Ratibida pinnata sn/fp (Gr), Rudbeckia hirta sn/fp (Rb, Gr), Rudbeckia laciniata sn/fp (Gr), Rudbeckia subtomentosa sn (Rb), Senecio aureus sn/fp (Gr), Solidago canadensis sn/fp (Rb, Gr, Re), Solidago juncea sn/fp (Gr), Solidago missouriensis sn (Rb), Solidago nemoralis sn fp (Rb, Re), Solidago ulmifolia sn (Rb), Tanacetum vulgare sn/fp (Gr); Bignoniaceae: Campsis radicans [exfl sn] (Rb); Boraginaceae: Hackelia virginiana sn fq (Rb); Brassicaceae: Capsella bursa-pastoris sn fp (Rb), Lepidium virginicum sn (Rb); Caesalpiniaceae: Chamaecrista fasciculata [exfl sn] (Rb); Caprifoliaceae: Sambucus canadensis fp (Rb), Symphoricarpos occidentalis sn/fp (Gr), Symphoricarpos orbiculatus sn fq (Rb), Viburnum dentatum sn (Rb), Viburnum opulus (KM), Viburnum prunifolium sn (Rb); Caryophyllaceae: Stellaria media sn (Rb); Cornaceae: Cornus canadensis (BH), Cornus obliqua sn (Rb); Cucurbitaceae: Echinocystis lobata sn (Rb); Euphorbiaceae: Chamaesyce nutans sn (Rb), Euphorbia corollata sn fq (Rb); Fabaceae: Melilotus alba sn (Rb); Hamamelidaceae: Hamamelis virginiana sn/fp (Gr); Hydrangeaceae: Hydrangea arborescens sn fp (Rb); Lamiaceae: Agastache nepetoides fp np (Rb), Blephilia ciliata sn/fp (Cng), Blephilia hirsuta fp fq np (Rb), Lycopus americanus sn (Rb), Mentha arvensis sn (Rb), Monarda fistulosa fp np (Re), Nepeta cataria sn/fp (Rb, Re), Pycnanthemum pilosum sn fq (Rb), Pycnanthemum tenuifolium sn fq (Rb), Pycnanthemum virginianum sn/fp (Rb, Re), Scutellaria parvula fp np (Rb), Teucrium canadense sn/fp (Cng); Liliaceae: Camassia scilloides sn (Rb), Melanthium virginicum sn np (Rb), Smilacina stellata sn/fp (Gr), Stenanthium gramineum sn (Rb); Lythraceae: Ammannia coccinea sn (Rb); Melastomataceae: Rhexia virginica fsp np (LBt); Nelumbonaceae: Nelumbo lutea fp (Rb); Oxalidaceae: Oxalis stricta fp np (Rb); Parnassiaceae: Parnassia glauca sn/fp (Gr); Phytolaccaceae: Phytolacca americana sn fq (Rb); Polygonaceae: Fallopia scandens sn (Rb), Persicaria hydropiperoides sn (Rb), Persicaria pensylvanica sn (Rb), Persicaria punctata sn (Rb), Persicaria vulgaris sn fq (Rb); Portulacaceae: Claytonia virginica sn (Rb), Portulaca oleracea sn (Rb); Ranunculaceae: Clematis virginiana [stam sn fq] (Rb); Rhamnaceae: Ceanothus americanus sn (Rb), Rhamnus lanceolata sn (Rb); Rosaceae: Aronia melanocarpa fq (Sm), Crataegus crus-galli sn (Rb), Potentilla norvegica sn (Rb), Potentilla simplex sn (Rb), Prunus serotina [flwr sn] (Rb), Rosa setigera fp np (Rb), Rubus allegheniensis fp (Rb), Spiraea alba (Sm); Rubiaceae: Cephalanthus occidentalis sn (Rb), Galium trifidum sn (Rb), Houstonia lanceolata sn (Rb); Rutaceae: Ptelea trifoliata sn (Rb); Salicaceae: Salix discolor [unsp sn/fp] (Gr), Salix interior [stam sn] (Rb), Salix nigra [stam sn] (Rb), Salix rigida [stam sn] (Rb); Santalaceae: Comandra umbellata sn (Rb); Saxifragaceae: Saxifraga pensylvanica sn/fp (Gr); Scrophulariaceae: Mimulus ringens fp np (Cng), Verbascum thapsus fp np (Rb), Veronicastrum virginicum sn (Rb); Verbenaceae: Phyla lanceolata sn (Rb), Verbena hastata sn (Cng), Verbena urticifolia sn fq (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Foodplant / saprobe
larva of Syritta pipiens is saprobic on decaying bulb of Narcissus

Animal / dung/debris feeder
larva of Syritta pipiens feeds on dung/debris wet manure of Mammalia

Animal / parasitoid / endoparasitoid
larva of Trichopria clavatipes is endoparasitoid of larva of Syritta pipiens

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Flowers visited by adults: white umbellifers; Achillea, Allium, Aster, Calluna, Cardamine, Cirsium palustre, Convolvulus, Crataegus, Epilobium, Euphorbia, Galium, Jasione montana, Leontodon, Polygonum cuspidatum, Potentilla erecta, Prunus laurocerasus, Ranunculus, Rosa canina, Senecia jacobaea, Sorbus aucuparia, Tussilago (Speight 2010). See also the extended list in de Buck (1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Adults have low-flying, rarely more than 1 m. from the ground; settles on vegetation; males patrol stands of low-growing plants in bloom (see Parmenter 1956) (Speight 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

The flight period for European specimens is from March to November, and in southern Europe probably all the year round, but most records are from May through October (Speight 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Larva of S. pipiens was described and figured by Heiss (1938) and Hartley (1961) and illustrated in colour by Rotheray (1994) and Bartsch et al (2009a); an inhabitant of various types of moist, decaying, vegetable matter, including cow dung and garden compost heaps (Speight 2010).

Larva (from Heiss 1938).

The immature stages of Syritta pipiens have been described in detail and figured by Metcalf (1916). The rectal gills, posterior spiracles, and cross section of the pharynx are figured by Kroger (1926) who gives an exhaustive morphological account of the larva. Hodson (1931) describes the larva and puparium of Syritta pipiens in comparison with those of Eumerus tuberculatus and figures the cephalopharyngeal skeleton, larva, and puparium of both. Johannsen (1935) describes again the larva and puparium of Syritta pipiens, using the descriptions of Metcalf and the figures of Metcalf and Kruger.

Length, 10 mm., width, 2.75 mm., height, 2 mm. The larva is broadly fusiform, tapering moderately toward the false head and more narrowly at the posterior end, and broadest from segments five to nine. The color is dirty yellowish and the entire body is covered with pale and delicate, close-set microscopic hairs, which are longer on the more exposed portions. The body bears, just anterior to the posterior respiratory process, three pairs of pointed fleshy projections.

The anterior segments are differentiated into a false head with about a dozen longitudinal furrows. The anterior spiracles are very dorsal in position, located between the first and second furrow from the midline and are sessile, each with apparently three rounded nodules on its summit. The head has a transverse band of microscopic hooklets above the mouth. There are seven pairs of prolegs; each proleg has about two dozen hooklets of varying sizes. On segments eleven and twelve are the conspicuous lateral processes, the anterior, shortest one on the eleventh, the middle and posterior ones, which are progressively longer, on the twelfth. They are covered with spinelets, which are longer toward the tip.

The posterior respiratory process is a brown, chitinized polished tube, about 0.75 mm. long. It is straight, tapering, and very slender, about five times as long as its width at the tip. The tubes are semitransparent, permitting the large tracheal trunks to be seen throughout its length. The posterior spiracular plates have centrally located circular plates and three pairs of contorted spiracles which are ornamented around the edge with from nine to fourteen lateral projections or denticles which are irregular in size and irregularly shaped. The plates are each surrounded by four tufts of feathered hairs.

According to Kruger (1926) the rectal gills are twelve-branched.

Recognition Characters. 1. Yellowish larvae about 10 mm. long with three pairs of posterior fleshy processes, the first shortest and the last longest. 2. Seven pairs of prolegs each with two dozen hooklets of varying sizes. 3. Shape of the aperture of the spiracles contorted and irregularly toothed with nine to fourteen denticles. 4. Slender, straight posterior process, tapering toward the tip and five times as long as wide at the top.

Puparium (from Heiss 1938).

Length, 6.8 mm., width, 2.95 mm., height, 2.68 mm. Elongate-ovate in outline, a little more attenuated posteriorly, nearly circular as seen from the front, a little flattened on the venter. Color yellowish white, darkening to dull muddy brown. The remnants of the three pairs of projections are still readily visible on the anal segments but the prolegs have disappeared and even the hooklets are difficult to find on the general roughened and soiled integument.

The pupal respiratory processes protrude from the upper half of the operculum as blunt, club-shaped projections. The enlarged distal half is studded with about 75 minute nodules in which are found the spiracular apertures. The posterior spiracular process is like that of the larva.

Food Habits.The stages of Syritta pipiens have been reported from cow and horse manure, from guinea pig manure and from human excrement. It has also been found in decayed and rotting tulip bulbs and in heaps of vegetable refuse (Hodson, 1931).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Mengual, Ximo

Source: Flower flies (Syrphidae)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Syritta pipiens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Syritta pipiens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATATTTGGAACTTGAGCAGGATTAGTAGGAACTTCCTTAAGAATTCTTATTCGAGCCGAATTAGGTCACCCTGGAGCTTTAATTGGAGATGACCAAATTTATAACGTAATTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGAAATTGACTAGTTCCTTTAATACTGGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGACTTTTACCTCCTTCTTTAACTTTATTATTAGTAAGTAGTATAGTAGAAAACGGAGCAGGAACAGGATGAACAGTGTATCCTCCTTTGTCAGCAGGAATTGCTCATAGTGGAGCTTCTGTAGATCTAGCAATCTTTTCTTTACATTTAGCAGGAATATCATCCATTTTAGGAGCTGTAAATTTTATTACAACTGTAATTAACATACGAGCAGCAGGAATAACATATGATCGAATACCTTTATTTGTATGATCAGTAGTTATTACAGCTCTTCTTCTTTTATTATCATTGCCAGTTTTAGCAGGTGCAATTACAATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTCGACCCTGCTGGAGGAGGAGACCCAATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Syritta pipiens

Syritta pipiens is a very common species of European hover fly. Sometimes called the thick-legged hoverfly, from its distinctive broad hind femora. They are fast nimble fliers, Larvae feed in rotting organic matter.[2]

In flight

References[edit]

  1. ^ Stubbs, Alan E.; Falk, Steven J. (1983). British Hoverflies: An Illustrated Identification Guide. British Entomological & Natural History Society. pp. 253, xvpp. 
  2. ^ Van Veen, M.P. (2004). Hoverflies of Northwest Europe, Identification Keys to the Syrphidae (hardback). Utrecht: KNNV Publishing. p. 254. ISBN 90-5011-199-8. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!