Ecology

Associations

Animal / associate
larva of Xylota segnis is associated with larva of Hylobius abietis

Foodplant / saprobe
larva of Xylota segnis is saprobic on sap run and decaying sap of Abies

Foodplant / saprobe
larva of Xylota segnis is saprobic on wet, decaying tuber of Solanum tuberosum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Xylota segnis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Xylota segnis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTACTACCTCCTTCTTTAACTTTACTATTAGTAAGAAGAATAGTAGAAAATGGAGCTGGTACTGGATGAACAGTTTATCCTCCTCTTTCAGCAAGAATTGCTCATGGTGGTGCATCAGTTGATTTAGCAATTTTCTCTCTTCACTTAGCAGGAATATCTTCTATTTTAGGGGCAGTAAATTTTATTACTACAGTTATTAATATACGATCAACTGGAATTACTTATGATCGTATACCTTTATTTGTATGATCTGTTGTAATTACAGCTTTATTACTTCTTTTATCTTTACCAGTTTTAGCAGGAGCAATTACTATACTTCTTACTGATCGAAATTTAAATACATCATTTTTTGACCCAGCAGGAGGAGGTGATCCAATTTTATATCAACACTTATTTTGATTCTTTGGTCATCCAGAAGTTTATATTTTAATTCTTCCTGGATTTGGAATAATTTCTCACATTATTAGCCAAGAATGTGGAAAAAAGGAAACATTCGGATCTTTAGGAATAATTTATGCTATATTAGCTATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGGTGGAATAGACGTTGATACACGAGCTTATTTTACTTCAGCAACAATAATTATTGCTATTCCTACTGGAATTAAAATTTTTAGTTGATTAGCAACACTTCATGGAACT---CAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Xylota segnis

Xylota segnis is a common European species of hoverfly.[1]

Biology[edit]

Adults feed by grazing on anemophilous pollen grazed from surface of leaves. [2]Larvae are normally associated with decaying tree sap,[3] but have also been found in decaying human remains. [4]

References[edit]

  1. ^ Stubbs, Alan E. and Falk, Steven J. (1983). British Hoverflies: An Illustrated Identification Guide. British Entomological & Natural History Society. pp. 253, xvpp. 
  2. ^ Rotheray, Graham E.; Gilbert, Francis (2011). The Natural History of Hoverflies. Tresaith: Forrest Text. pp. 1–348. ISBN 978-0956469212. 
  3. ^ Rotheray, Graham E. (1993). "Colour Guide to Hoverfly Larvae Diptera, Syrphidae in Britain and Europe". Dipterists Digest. 1 (Dipterists Forum) 9: 156. ISSN 0953-7260. Retrieved 20 December 2013. 
  4. ^ Moffatt, Colin (2013). "Xylota segnis (L.) (Diptera:Syrphidae) found feeding on human remains". British Journal of Entomology and Natural History (British Entomological and Natural History Society) 26 (4): 243. ISSN 0952-7583. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!