Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Paragus albifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Paragus albifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTACCTCCTTCCTTAACATTACTACTAATAAGTAGAATAGTAGAAAATGGATCTGGTACAGGTTGAACTGTTTACCCTCCTCTTTCTGCTAGAATTGCTCATGGAGGAGCTTCTGTTGATCTAGCTATTTTTTCTTTACATTTAGCTGGTATATCATCAATTTTAGGGGCTGTAAATTTTATTACAACAGTAATTAATATACGAACAAATGGTATTACGTATGATCGAATACCTTTATTTGTCTGATCAGTTGTAATTACAGCTCTATTACTTCTATTATCATTACCAGTATTAGCCGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCAGGAGGGGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTCTTCCAGGATTTGGAATAATTTCTCATATTATTAGTCAAGAATCTGGGAAAAAAGAAACTTTTGGATCTTTAGGAATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTTGGAATAGATGTAGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Paragus albifrons

Paragus albifrons, is a species of hoverfly. It is found from southern Europe across to eastern Asia.[1][2][3]

References[edit]

  1. ^ Stubbs, Alan E.; Falk, Steven J (1983). British Hoverflies: An Illustrated Identification Guide (2nd ed.). London: British Entomological and Natural History Society. pp. 253, xvpp. ISBN 1-899935-03-7. 
  2. ^ Ball, S.G.; Morris, R.K.A. (2000). Provisional atlas of British hoverflies (Diptera, Syrphidae). Monks Wood, UK: Biological Record Centre. pp. 167 pages. ISBN 1-870393-54-6. 
  3. ^ Van Veen, M.P. (2004). Hoverflies of Northwest Europe, Identification Keys to the Syrphidae (Hardback). Utrecht: KNNV Publishing. p. 254. ISBN 90-5011-199-8. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!