Ecology

Associations

Animal / parasitoid
larva of Syrphoctonus fissorius is parasitoid of aphidivorous larva of Epistrophe eligans
Remarks: season: spring

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epistrophe eligans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTTTATTTGGTTCCTGAGCTGGAATAGTAGGTACATCCTTAAGAATTTTGATTCGAGCAGAACTTGGTCATCCAGGTGCTTTAATTGGAGATGACCAAATTTATAATGTAATTGTTACTGCTCATGCTTTCGTAATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCCTTTCCCCGAATAAATAATATAAGTTTTTGACTATTACCTCCCTCTTTAACACTTTTATTAGTAAGAAGAATAGTAGAAAATGGAGCTGGAACAGGTTGAACAGTTTATCCACCTTTATCCGCTAATATTGCTCATGGAGGAGCTTCAGTTGATTTAGCTATTTTCTCTCTTCATCTAGCTGGTATATCTTCTATTTTAGGAGCAGTTAATTTTATTACAACTGTTATTAATATACGTTCTAATGGTATTTCCTATGATCGAATACCTTTATTTGTATGATCAGTAATAATTACTGCATTATTACTTCTTTTATCATTACCAGTTCTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epistrophe eligans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Epistrophe eligans

Epistrophe eligans is a European species of hoverfly.[1][2][3][4]

References[edit]

  1. ^ Ball, S.G.; Morris, R.K.A. (2000). Provisional atlas of British hoverflies (Diptera, Syrphidae). Monks Wood, UK: Biological Record Centre. pp. 167 pages. ISBN 1-870393-54-6. 
  2. ^ Morris, Roger K. A. (1999). Hoverflies of Surrey. Surrey Wildlife Trust. p. 244. ISBN 0-9526065-3-4. 
  3. ^ Stubbs, Alan E.; Falk, Steven J. (1983). British Hoverflies: An Illustrated Identification Guide. British Entomological & Natural History Society. p. 253, xvpp. 
  4. ^ Van Veen, M.P. (2004). Hoverflies of Northwest Europe, Identification Keys to the Syrphidae (hardback). Utrecht: KNNV Publishing. p. 254. ISBN 90-5011-199-8. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!