Ecology

Associations

Animal / parasitoid
larva of Diplazon laetatorius is parasitoid of larva of Eupeodes corollae

Animal / parasitoid
larva of Diplazon tetragonus is parasitoid of larva of Eupeodes corollae

Animal / predator
larva of Eupeodes corollae is predator of Aphidoidea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupeodes corollae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATTACCTCCATCTTTAACTCTTCTATTAGTAAGAAGAATAGTTGAAAATGGGGCTGGAACTGGTTGAACAGTTTACCCTCCACTTTCTGCTAGTATTGCACATGGAGGAGCTTCTGTTGATTTA---GCTATTTTTTCTCTTCATTTAGCTGGAATATCATCAATTTTAGGGGCTGTAAATTTTATTACTACAGTAATTAATATACGATCTAATGGAATTTCTTATGATCGTATACCTTTATTTGTATGATCAGTAGTAATTACTGCTTTATTATTACTTTTATCATTACCAGTATTAGCAGGA---GCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTCTTTGACCCAGCAGGAGGAGGAGATCCAATTCTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATTATTAGTCAAGAATGTGGAAAAAAG---GAAACATTTGGATCTTTAGGAATAATTTATGCTATATTAGCTATTGGTTTACTAGGATTTATTGTATGAGCTCATCATATATTTACAGTAGGTATAGATGTAGATACACGAGCTTATTTTACATCTGCTACTATAATTATTGCAATTCCAACAGGAATTAAAATTTTCAGTTGATTA---GCAACATTACATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eupeodes corollae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 35
Specimens with Barcodes: 60
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eupeodes corollae

Eupeodes corollae is a very common European species of hoverfly.[1] Adults are 6–11 millimetres (0.24–0.43 in) in body length. Males and females have different marking on the abdomen; males have square commas on tergites 3 and 4, whereas females have narrow commas. Larvae feed on aphids. This species has been used experimentally in glasshouses as a method of aphid control,[2] and to control scale insects and aphids in fruit plantations. They were found to be partial to the fruit, eating more fruit than aphids.[3]

E. corollae is found across Europe, North Africa and Asia. Adults are often migratory.[4]

References[edit]

  1. ^ Stubbs, Alan E. and Falk, Steven J. (1983). British Hoverflies: An Illustrated Identification Guide. British Entomological & Natural History Society. p. 253, xvpp. 
  2. ^ Santos Rojo, Keith R. Hopper and M. Angeles Marcos-García (2004). "Fitness of the hover flies Episyrphus balteatus and Eupeodes corollae faced with limited larval prey". Journal Entomologia Experimentalis et Applicata (Springer Netherlands) 81 (1): 53–59. doi:10.1007/BF00187838. ISSN 0013-8703. 
  3. ^ Jacopo Rossi, Ursula Gamba, Massimo Pinna, Sandra Spagnolo, Cristina Visentin, Alberto Alma (2006). "Hoverflies in organic apple orchards in north-western Italy". Bulletin of Insectology (Bologna: Facolta' Di Agraria Universita' Di Bologna) 59 (2): 111–114. ISSN 1721-8861. Retrieved 8 January 2009. 
  4. ^ Van Veen, M.P. (2004). Hoverflies of Northwest Europe, Identification Keys to the Syrphidae (Hardback). Utrecht: KNNV Publishing. p. 254. ISBN 90-5011-199-8. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!