Overview

Brief Summary

Anopheles quadrimaculatus, the common malaria mosquito, is a large dark mosquito, recently discovered through genetic testing to be a complex of five sibling species, so is often referred to as "A. quadrimaculatus sensu lato". It is native to eastern North America with a range from southern Canada to Florida, west to Minnesota and also to parts of Mexico. Most active in summer months and in warm climates, this species can have up to 10 generations in a year, and overwinters in its adult phase. Its preferred hosts are humans and other large mammals; females will repeatedly bite a host for blood (males eat only nectar). Adult Anopheles quadrimaculatus frequent houses and other man-made shelters and have a less painful, and thus less noticeable, bite than other mosquito species. Because it prefers clean water for breeding, A. quadrimaculatus does well in rural swamps and wetlands and produces more adults in these habitats than in smaller containers and ditches associated with humans. This mosquito had the distinction of being the most common vector of malaria in North America until the eradication of this disease from this part of the world in 1950. Anopheles quadrimaculatus is still identified in vectoring occasional cases of local transmission of malaria in the eastern United States, as well transmitting other disease pathogens such as Cache Valley virus, West Nile Virus and St. Louis encephalitis. It is a common and important host for dog heartworm (Dirofilaria immitis) and can be a vector for the myositic parasite Trachipleistophora hominis. In addition to being a disease vector, A. quadrimaculatus is also a significant pest species in its own right. Anopheles quadrimaculatus populations can be monitored using resting box collections and carbon dioxide traps. (CABI 2009; Reinert and Seawright 1997; Rios and Connelly 2007; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Anopheles quadrimaculatus is a common mosquito found in the United States, primarily in the eastern half of the country with ranges from the Texas Panhandle to the East Coast. The largest densities of the species are found in the southeastern United States. Anopheles quadrimaculatus is also found in Mexico and southern Canada, including Ontario and Quebec.

Biogeographic Regions: nearctic (Native )

  • La Casse, W., S. Carpenter. 1955. Mosquitoes of North America (North of Mexico). Berkeley, California: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Anopheles quadrimaculatus is a medium sized mosquito that is light brown in color. The tips of the wings lack the copper color seen in many other species. Females have a body length of about 5 mm and wing lengths also near 5 mm. Females also have a long proboscis and labella with small black setae; palpi are the same length as the proboscis. Antennae are filiform and the abdomen is black with many yellow-colored hairs. As in most members of the genus Anopheles, male antennae are more complex than those of females. Male A. quadrimaculatus can be identified by observing their large plumose antennae with long brown hairs that have a yellow luster. Males are also sexually dimorphic in the appearance of their palpi as the last two joints are larger and have many long brown hairs. Males have a body length of 5.5 mm and wing lengths of 4.5 mm. Anopheles quadrimaculatus can be differentiated from other species through the presence of broadly rounded wing scales on the proximal end of the cubitus. The scales of the wings also form four distinct dark spots which makes it fairly easy to distinguish from other Anopheles species.

Larvae of A. quadrimaculatus have long, rounded heads with single dorsal hairs that are highly branched. The thorax is rounded with short branched hairs and hair tufts. Long feathered hairs are present on the first three abdominal segments. The other abdominal segments have shorter hairs that are less branched. Palmate hairs on the second abdominal segment are also pigmented. Larvae of the genus Anopheles can be distinguished from Culex species by observing the presence or absence of the respiratory siphon located on the rear end. Mosquito larvae of the genus Anopheles do not have siphons while larvae of the genus Culex do. Pupae of Culex and Anopheles show very few differences, although pupae of Anopheles are generally larger. Eggs of A. quadrimaculatus are generally dark in color and more pointed at one end than the other.

Range length: 5.0 to 5.5 mm.

Range wingspan: 4.5 to 5.0 mm.

Sexual Dimorphism: male larger; sexes shaped differently

Other Physical Features: ectothermic ; bilateral symmetry

  • Dyar, H. 1928. The mosquitoes of the Americas. Washington: Carnegie Institution of Washington. Accessed February 17, 2010 at http://hdl.handle.net/2027/mdp.39015024037056.
  • Headlee, T. 1945. The Mosquitoes of New Jersey and Their Control. New Brunswick: Rutgers University Press.
  • U.S. Department of Agriculture, Bureau of Entomology. The Mosquitoes of the United States. Bulletin Number 25. Washington: Government Printing Office. 1900. Accessed February 17, 2010 at http://hdl.handle.net/2027/mdp.39015069645607.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Anopheles quadrimaculatus can be found in many different habitats depending on its stage of life. Larvae are found in freshwater aquatic environments including ponds, swamps and bayous. They can also be found in slow moving canals and streams. Anopheles quadrimaculatus larvae seem to be more prevalent in aquatic environments that contain vegetation and in areas that are exposed to sunlight. Although they are most commonly found in clean water, they are sometimes found in heavily polluted water. Anopheles quadrimaculatus larvae also utilize manmade objects that are filled with water including agricultural ponds and fields, cans, barrels and old tires. Adults are typically found near aquatic habitats. During daylight hours A. quadrimaculatus adults are normally found in sheltered areas. These areas include hollow trees, animal stables and human habitats as well as many other man-made shelters. Anopheles quadrimaculatus adults have been collected at elevations as high as 300 meters.

Range elevation: 0 to 300 m.

Habitat Regions: temperate ; tropical ; terrestrial ; freshwater

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; temporary pools; brackish water

Wetlands: marsh ; swamp ; bog

Other Habitat Features: urban ; suburban ; agricultural

  • Boyd, M. 1949. Malariology: a Comprehensive Survey of All Aspects of This Group of Disease From a Global Standpoint. Philadelphia: Saunders. Accessed February 17, 2010 at http://hdl.handle.net/2027/mdp.39015019376519.
  • Foote, R., D. Cook. 1959. Mosquitoes of medical importance. Washington: Agricultural Research Service, U. S. Dept. of Agriculture. Accessed February 17, 2010 at http://hdl.handle.net/2027/mdp.39015003812107.
  • Horsfall, W. 1972. Mosquitoes Their Bionomics and Relation to Disease. New York: Hafner Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Larvae of Anopheles quadrimaculatus feed on food particles that are within one to two meters from the surface of the water. Observations indicate that larvae feed on many different aquatic organisms and seem to have no preference for what they consume. The only requirement for the food is the size, however if the food particles are too large they may macerate them before consumption. Filamentous algae is typically macerated by running the food across the mandibles while consuming particles that break off. The maximum food particle size increases with each larval instar ranging from 37 microns to 131 microns. In natural habitats larvae typically feed on detritus, plankton, and filamentous algae. Larvae have been kept alive through development in the laboratory by feeding only yeast, algae, broken hay or ground dog biscuits.

Adults of A. quadrimaculatus have different feeding patterns, depending on the sex. Both males and females feed on many different species of plants for sugars and nectar. Laboratory experiments show that both species can be kept alive by feeding glucose, honey or other sugar syrups. To produce eggs females must feed on blood. They will feed on many animals including humans, cows, horses, pigs, sheep, dogs, cats and also some birds. Many observations have been made on blood feeding of A. quadrimaculatus and there have been mixed results on the preferred host and the amount of feeding on human hosts as the hosts available depend on the habitat of the mosquito. Adults typically feed from dusk until sunrise; however they will feed during the day if hosts are readily available. Feeding times can vary depending on host species as well as environmental conditions. The mouth parts of the females are specially designed for blood feeding through solenophagy. They are able to use a special anti-coagulant that is very powerful, even in 1:10,000 or greater dilutions, to assist in feeding. This anti-coagulant is introduced into the blood before the mosquito feeds, in order to prevent the blood from solidifying inside of the mosquito.

Animal Foods: blood

Plant Foods: nectar; sap or other plant fluids; algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: herbivore (Nectarivore )

  • Metcalf, R. 1945. The physiology of the salivary glands of Anopheles quadrimaculatus. The Journal of the National Malaria Society, Volume 4, Issue 3: 271-278.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

The primary ecosystem role of Anopheles quadrimaculatus seems to be its role as a vector for various diseases. It is the most important vector of malaria in the United States as it is a competent vector of Plasmodium falciparum, Plasmodium vivax and Plasmodium malariae. Other important human diseases can also be transmitted by A. quadrimaculatus including Cache Valley virus and West Nile virus. In lab studies it has also been shown to be a vector for St. Louis encephalitis. It is also a very common vector of heartworms, Dirofilaria immitis. At least three species of Plasmodium are also transmitted to birds through A. quadrimaculatus, however the rate of infection is undetermined. Aside from its role as a disease vector, A. quadrimaculatus larvae are a common source of food for many aquatic insects such as shore bugs as well as many species of ants, fish and ducks. Adults are also a common source of food for many species of birds and bats, however specific examples are unknown. Anopheles quadrimaculatus adult females are temporary ectoparasites of many vertebrates including cattle, horses, pigs, birds, humans, and domestic cats and dogs.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are many different predators of mosquitoes, however few specific species of predators of Anopheles quadrimaculatus have been named. In general many species of birds and bats are known to feed primarily on adult mosquitoes. Larvae and pupae are commonly eaten by many different predators including carnivorous insects, as well as many species of fish and aquatic fowl. When water levels decrease and larvae and pupae are stranded on land, other insects such as shore bugs as well as many species of ants will feed on them.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Anopheles quadrimaculatus is able to communicate through very distinct but low energy sounds. Females produce sounds with higher energy than males; however both sexes appear to have similar sounds for mating, alerting of danger, or anger. Many males will respond to the mating call of a single female with the sounds being picked up by their antennae. These sounds are made in a variety of ways including beating of the wings and rubbing the tarsi against the wings. As in other mosquito species, A. quadrimaculatus finds hosts through olfactory receptors and are attracted by carbon dioxide and ammonia as well as other odors. Maxillary palps are able to detect carbon dioxide while antennae are able to detect host odors. Anopheles quadrimaculatus may be particularly sensitive to carbon dioxide as it often bites humans on their heads. It is believed that each species uses specific odors to locate their hosts, however little information exists on this topic. Studies have also shown that these mosquitoes are also attracted by the heat and moisture of their hosts.

Communication Channels: visual ; acoustic

Perception Channels: visual ; infrared/heat ; acoustic ; chemical

  • Dekker, T., W. Takken, B. Knols, E. Bouman, S. Laak, A. Bever, P. Huisman. 1998. Selection of biting sites on a human host by Anopheles gambiae s.s., An. arabiensis and An. quadriannulatus. Entomologia Experimentalis et Applicata, 87: 295-300.
  • Enserink, M. 2002. What Mosquitoes Want: Secrets of Host Attraction. Science, Vol. 298, No. 5591: 90-92. Accessed February 25, 2010 at http://www.jstor.org/stable/3832706.
  • Kahn, M., W. Celestin, W. Offenhauser. 1945. Recording of Sounds Produced by Certain Disease-Carrying Mosquitoes. Science, Vol. 101, No. 2622: 335-336. Accessed February 24, 2010 at http://www.jstor.org/stable/1672457.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Anopheles quadrimaculatus goes through four stages in its life cycle, progressing through egg, larva and pupa stages to the adult form. Egg, larval and pupal stages all occur in aquatic environments. Developmental times in each stage can vary dramatically depending on the temperatures experienced. Eggs normally hatch within one to three days following oviposition with a mean time of two days; however hatching time can be longer with colder temperatures. Anopheles quadrimaculatus has four larval instars lasting a minimum of twelve days following oviposition with an average of nineteen days under normal conditions. Metamorphosis from larva to adult occurs during the pupal stage, which can last anywhere from two to six days in total with an average of two days, after which fully developed adults emerge. The total life cycle from egg to adult takes a minimum of fourteen days and a maximum of twenty-seven days with a mean of twenty-one days when water temperatures are 74° F.

Development - Life Cycle: metamorphosis

  • 2008. "Anopheles Mosquitoes" (On-line). Accessed February 24, 2010 at http://www.cdc.gov/malaria/about/biology/mosquitoes/.
  • Entomology and Nematology Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. Common malaria Mosquito Anopheles quadrimaculatus Say. EENY-419. University of Florida: Leslie M. Rios and C. Roxanne Connelly. 2009. Accessed February 10, 2010 at http://edis.ifas.ufl.edu/pdffiles/IN/IN79100.pdf.
  • Keener, G. 1945. Detailed Observations on the Life History of Anopheles Quadrimaculatus. The Journal of the National Malaria Society, Volume 4, Issue 3: 263-270.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Females of Anopheles quadrimaculatus typically live much longer than males, averaging about 21 days as compared to about 7 days for males. The maximum lifespan observed of a female is 62 days while the maximum male lifespan is significantly shorter at 22 days. Females that overwinter die immediately following oviposition in the spring. There are many different measurements for the lifespan of these mosquitoes; however they vary significantly depending on conditions and sex. Factors that affect lifespan include temperature and humidity as well as host abundance and the presence of predators.

Range lifespan

Status: captivity:
22 (male) to 62 (female) days.

Average lifespan

Status: wild:
7 (males); 21 (females) days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Members of Anopheles quadrimaculatus are polygynandrous as both males and females have more than one mate throughout the breeding season.

Mating System: polygynandrous (promiscuous)

Mating occurs near aquatic environments, especially near ponds with vegetation. Female A. quadrimaculatus are sexually mature and able to mate as soon as they emerge from the pupal stage. Sexually mature males typically stay in vegetation and wait for females to emerge from the pupa. As females leave the pupa, males locate them and mating occurs in flight for about ten to fifteen seconds. After mating, females require a blood meal for eggs to become completely mature. The first brood of eggs is normally laid in April or May after blood feeding begins and proper temperature for egg development is reached. Breeding may occur through November, depending on temperatures throughout the breeding season. Eggs are laid on the surface of water in ponds and other aquatic environments and are specially designed to float with a certain orientation on the water’s surface. Females typically oviposit within two to three days after taking a blood meal. Laboratory observations indicated that female A. quadrimaculatus are able to lay nine to twelve broods of eggs during their lifetime, each consisting of 194 to 263 eggs. Once oviposition occurs females are able to breed again immediately, continuing this cycle until the end of their lives.

Breeding interval: Common malaria mosquitoes breed 9 to 12 times per year depending on geographic location and climatic conditions.

Breeding season: The breeding season for common malaria mosquitoes occurs from early spring to late fall primarily depending on temperatures.

Range eggs per season: 1100 to 3100.

Range gestation period: 2 to 3 days.

Range age at sexual or reproductive maturity (female): Immediately after emerging from the pupal stage (low) minutes.

Range age at sexual or reproductive maturity (male): Immediately after emerging from the pupal stage (low) minutes.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

After mating and oviposition, Anopheles quadrimaculatus has no additional parental investment in its young.

Parental Investment: no parental involvement

  • 2008. "Anopheles Mosquitoes" (On-line). Accessed February 24, 2010 at http://www.cdc.gov/malaria/about/biology/mosquitoes/.
  • Boyd, M. 1949. Malariology: a Comprehensive Survey of All Aspects of This Group of Disease From a Global Standpoint. Philadelphia: Saunders. Accessed February 17, 2010 at http://hdl.handle.net/2027/mdp.39015019376519.
  • Horsfall, W. 1972. Mosquitoes Their Bionomics and Relation to Disease. New York: Hafner Publishing Company.
  • Keener, G. 1945. Detailed Observations on the Life History of Anopheles Quadrimaculatus. The Journal of the National Malaria Society, Volume 4, Issue 3: 263-270.
  • La Casse, W., S. Carpenter. 1955. Mosquitoes of North America (North of Mexico). Berkeley, California: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anopheles quadrimaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGCTTGAGCAGGAATAGTAGGAACTTCTCTAAGTATTTTAATTCGAGCAGAATTAGGACACCCTGGAGCCTTTATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCTCTAATACTAGGGGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCCTCTTTAACTCTTCTAATTTCTAGAAGTATAGTAGAAAATGGAGCTGGAACAGGGTGAACTGTATATCCTCCTCTATCCTCAGGAATTGCTCATGCAGGAGCTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCAGTTAATTTTATTACAACAGTTATTAATATACGAGCCCCAGGAATTACTCTTGACCGAATACCGTTATTCGTTTGATCTGTAGTAATTACAGCAGTATTATTATTACTTTCTTTACCAGTATTAGCCGGAGCTATTACTATACTTTTAACAGATCGAAACTTAAATACATCATTCTTTGACCCAGCTGGGGGAGGGGACCCAATTTTATACCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles quadrimaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 94
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Anopheles quadrimaculatus A

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCGCGACAATGATTATTTTCAACTAACCATAAGGATATTGGAACATTATATTTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACTTCTCTAAGTATTTTAATTCGAGCAGAATTAGGACACCCTGGAGCCTTTATTGGTGATGATCAAATTTATAATGTTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCTCTAATACTAGGGGCCCCAGATATGGCTTTCCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCCTCTTTAACTCTTCTAATTTCTAGAAGTATAGTAGAAAATGGAGCTGGAACAGGGTGAACTGTATATCCTCCTCTATCCTCAGGAATTGCTCATGCAGGAGCTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCAGTTAATTTTATTACAACAGTTATTAATATACGAGCACCAGGAATTACTCTTGACCGAATACCGTTATTCGTTTGATCTGTAGTAATTACAGCAGTATTATTATTACTTTCTTTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAACTTAAATACATCATTCTTTGACCCAGCTGGGGGAGGGGAACCCAATTTATACCAACACTTATTTTGATTTTTTGGACACCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGTATAATTTCTCATATTATTACACAAGAAAGAGGTAAAAAGGAAACATTCGGAAACTTAGGAATAATTTATGCTATACTAGCTATTGGATTACTAGGGTTTATTGTTTGAGCTCATCACATATTTACAGTAGGAATAGACGTTGATACTCGAGCTTATTTTACTTCTGCTACTATAATTATTGCTGTACCTACAGGTATTAAAATTTTTAGTTGATTAGCAACAATACATGGTACACAATTAACTTATAGTCCTGCAATATTATGAGCTTTCGGATTTGTATTTTTATTTACAGTAGGAGGTTTAACCGGTGTAGTATTAGCTAATTCATCAATTGATATTGTTTTACATGATACATATTATGTAGTTGCCCATTTTCATTATGTGTTATCTATAGGGGCAGTCTTTGCTATTATAGCAGGGTTTATTCATTGATACCCATTACTAACAGGATTAACTATAAACCCTAATTGATTAAAGTTACAATTTGCAATAATATTTGTTGGAGTAAATTTAACCTTTTTCCCTCAACATTTCTTAGGGTTGGCCGGAATACCTCGACGATACTCAGATTTTCCAGATAGTTACTTAGCATGAAATATTGTATCATCTTTAGGAAGAACAATTTCTTTATTTGCTATTTTATACTTTTTATTTATTATTTGAGAAAGTATAATTACACAACGAACACCAGCATTCCCAATACAACTTTCTTCATCAATTGAGTGATACCACACCCTACCCCCTGCAGAACATACTTATGCAGAATTACCATTATTAACTAATAATTTCTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles quadrimaculatus A

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Anopheles quadrimaculatus populations are large throughout its wide geographical range and do not appear to be in danger of declining in the future. Any efforts to control population numbers are focused solely on reducing their numbers as they are primary vectors of disease.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The largest and most studied negative effect of Anopheles quadrimaculatus on humans is its role as the primary vector of malaria in the United States. Anopheles quadrimaculatus serves as the primary vector of the most pathogenic agent of malaria, Plasmodium falciparum as well as the less pathogenic strains of Plasmodium vivax and Plasmodium malariae. Although a competent vector exists, malaria has not been a major problem in the United States since the 1940’s. Since 1957, 63 outbreaks have occurred in the United States, causing 156 cases that were a result of mosquito transmission. Around 1,500 cases of malaria are reported in the United States each year however most are acquired outside of the United States. Due to increased global travel and the large presence of A. quadrimaculatus as a vector there is the potential for more widespread and severe outbreaks of malaria in the United States. The Centers for Disease Control and Prevention as well as state and local health departments monitor cases of malaria carefully and have many control measures in place.

Anopheles quadrimaculatus is also a vector for other human diseases including Cache Valley virus. Cache Valley virus is rarely diagnosed in the United States, however it has been observed most commonly in A. quadrimaculatus. It is not yet known if this mosquito is the primary vector in the United States. This mosquito also vectors West Nile virus, which can cause death in humans as well as many other species including birds, dogs, cats, and horses. In 2009 there were 663 cases reported in the United States, with 30 resulting in death. Since A. quadrimaculatus and many other mosquitoes are vectors of several human diseases, many efforts have been taken to reduce their population through the removal of breeding habitats (stagnant water) and the use of insecticides. Anopheles quadrimaculatus is also a common vector of Dirofilaria immitis which is the agent causing heart worm in dogs and cats. This disease can cause serious harm to these household pets and a great deal of money can be spent on preventive measures and treatments.

Negative Impacts: injures humans (bites or stings, causes disease in humans , carries human disease); causes or carries domestic animal disease

  • 2009. "CDC West Nile Virus Homepage" (On-line). Accessed April 01, 2010 at http://www.cdc.gov/ncidod/dvbid/westnile/index.htm.
  • Campbell, G., J. Mataczynski, E. Reisdorf, P. James W., D. Martin, A. Lambert, T. Haupt, J. Davis, R. Lanciotti. 2006. Second Human Case of Cache Valley Virus Disease. Emerging Infectious Diseases, Vol. 12, No. 5: 854-856. Accessed March 25, 2010 at http://www.cdc.gov/Ncidod/EID/vol12no05/pdfs/05-1625.pdf.
  • Centers for Disease Control and Prevention. Locally Acquired Mosquito-Transmitted Malaria: A Guide for Investigations in the United States. Morbidity and Mortality Weekly Report RR-13. Atlanta, GA: Department of Health and Human Services Centers for Disease Control and Prevention. 2006. Accessed April 01, 2010 at http://www.cdc.gov/mmwr/PDF/rr/rr5513.pdf.
  • University of Florida IFAS Extension. Mosquito-borne Dog Heartworm Disease. ENY-628. Vero Beach, FL: University of Florida. 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are no known positive effects of Anopheles quadrimaculatus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!