Articles on this page are available in 1 other language: Arabic (15) (learn more)

Overview

Distribution

National Distribution

Canada

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Aedes triseriatus, commonly called the tree hole mosquito, or eastern tree hole mosquito, is a species of mosquito found in the western hemisphere in wooded regions of eastern and central North America. It is quite prevalent, ranging from New Brunswick to the Florida Keys and stretching as far west as central Texas. (Horsfall 1955, Crans 2001)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Aedes triseriatus begins its life cycle as an egg laid close to a shallow pool of water by the female. Once the pool is flooded and conditions are right, the eggs hatch and free-swimming larvae emerge. The larvae feed in the pool, straining organic material and microorganisms from the water. Aedes triseriatus can be identified among other mosquito species at this stage because its body is longer than most other mosquito larvae. The larvae are gray colored and swim with a snake- like wriggle. The next stage in the mosquito's life cycle, the pupae, is also aquatic, with a thicker, darker, rounded body and a tail that propels them through the water. Following this stage, the adult emerges as a dark black mosquito with silvery white scales along the sides of its thorax. (These silvery-white scales are diagnostic.) The tarsi and proboscis are completely dark. The adult mosquito is a winged insect, with one pair of wings, three pairs of legs and the three distinct regions typical of an insect's body (the head, thorax and abdomen), as well as an extended mouth region called the proboscis for sipping nectar, and, in the females, sucking blood. (Walker 1992, Crans 2001, "The Biology of the Mosquito" 2001, "Mosquito Pest Management" 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Aedes triseriatus makes its home in areas where it can locate temporary pools of stagnant water, such as tree holes, abandoned tires, or leaf clogged gutters. It favors pools which contain leaf debris and other organic material to provide food for its larvae. Adults remain in areas near larval habitats throughout their lifespan. Multiple generations may coexist during periods of frequent flooding in the summer, and the last eggs layed during the summer lie dormant through the winter. This adaptation permits Aedes triseriatus to survive in environments which are too harsh for the fragile bodied adult mosquito. (Horsfall 1955, Carpenter and Durland 1982, Crans 2001).

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Females lay their eggs in containers of stagnant water to ensure a rich supply of nutrients and bacteria on which their larvae may feed. The larvae gain the energy they need for development by filtering through the organic material. While both male and female adult Aedes triseriatus feed mainly on nectar, deriving their energy from sugars, the female requires a blood meal to obtain proteins critical for the production of eggs, and thus functions as a parasite on birds and mammals. (Carpenter and Durland 1982, "Biology of the Mosquito" 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Aedes triseriatus preys on:
detritus
suspended organic matter

Based on studies in:
USA: Alabama (Plant substrate, Treeholes)

This list may not be complete but is based on published studies.
  • R. L. Kitching and S. L. Pimm, 1988. The length of food chains: phytotelmata in Australia and elsewhere. Proc. Ecol. Soc. Aust. 14:123-140, from p. 134 (from W. E. Snow, 1958, Stratification of arthropods in a wet stump cavity. Ecology 39(1):83-88, fr
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Aedes triseriatus is prey of:
Toxorhynchites rutilus septentrionalis

Based on studies in:
USA: Alabama (Plant substrate, Treeholes)

This list may not be complete but is based on published studies.
  • R. L. Kitching and S. L. Pimm, 1988. The length of food chains: phytotelmata in Australia and elsewhere. Proc. Ecol. Soc. Aust. 14:123-140, from p. 134 (from W. E. Snow, 1958, Stratification of arthropods in a wet stump cavity. Ecology 39(1):83-88, fr
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Mating takes place a few days to a week after the adults have first emerged. Female Aedes triseriatus only mate once, and sperm are transferred into a structure known as the spermathecae. These sperm can be used to fertilize multiple batches of eggs. Males die following mating. Aedes triseriatus commonly lays its eggs in dark tree holes and protected artificial containers (such as tires or cans) that may hold small amounts of still water, hence deriving its common name, the tree hole mosquito. Eggs are laid along the walls of the container and can withstand long periods (a year or more) without water, as well as cold temperatures, and hatch once their container is temporarily flooded.

The female mosquito lays her eggs slightly above the water level, if water is present in the hole. She lays them in a "zigzag" pattern, approximately 100- 150 at a time. Females require a blood meal for each batch of eggs produced, and can produce eggs throughout their lives. These female mosquitoes can live several weeks to several months.

(Horsfall 1955, Matheson 1929, "Vector Physiology" 2001, "Common Mosquitoes of Rhode Island" 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Aedes triseriatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Aedes triseriatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAATTTGATCAGGAANAGNNNGNACATCATTAAGAATTTTAGTTCGTGCCGAACTAAGCCAACCAGGAATATTTATTGGAAATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTCTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTCTGAATATTACCCCCTTCTTTAACTTTACTCCTTTCGAGTAGTATGGTAGAAAATGGGTCAGGAACAGGTTGAACCGTTTATCCCCCACTTTCATCTGGAACAGCCCATGCCGGAGCTTCAGTTGATTTAACAATTTTTTCCCTTCATTTAGCGGGAGTATCTTCAATTTTAGGAGCAGTAAATTTTATTACTACTGTTATTAATATACGATCATCAGGAATTACTTTAGATCGATTACCTTTATTCGTTTGATCTGTTGTAATTACAGCAATTTTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCTTTCTTTGATCCTATTGGAGGAGGAGACCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aedes triseriatus like many mosquito species, is a very hardy organism, and most ecological focus is aimed at controlling it rather than concern for its ability to propagate. ("Mosquito Pest Management" 2001).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species of mosquito is a special problem as an ectoparasite because it feeds on both birds and mammals, and thus can harbor and transfer a variety of viruses, posing a threat to humans and other mammals. Aedes triseriatus has been identified as a vector of Eastern Equine Encephalitis and linked to the spread of LaCrosse Encephalitis.

(Bates 1949, "Mosquito Pest Management Bulletin" 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Aedes triseriatus may certainly play a role in the food chain and ecosystem of its woodland habitats, but as an ectoparasite it is not considered to be of direct benefit to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ochlerotatus triseriatus

Ochlerotatus triseriatus is also known by the synonym Aedes triseriatus and is a member of the true fly family. This species is a tree hole breeding mosquito in eastern North America. It is a known vector of LaCrosse Encephalitis

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!