Articles on this page are available in 1 other language: Arabic (15) (learn more)

Overview

Distribution

National Distribution

Canada

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Known prey organisms

Aedes triseriatus preys on:
detritus
suspended organic matter

Based on studies in:
USA: Alabama (Plant substrate, Treeholes)

This list may not be complete but is based on published studies.
  • R. L. Kitching and S. L. Pimm, 1988. The length of food chains: phytotelmata in Australia and elsewhere. Proc. Ecol. Soc. Aust. 14:123-140, from p. 134 (from W. E. Snow, 1958, Stratification of arthropods in a wet stump cavity. Ecology 39(1):83-88, fr
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Aedes triseriatus is prey of:
Toxorhynchites rutilus septentrionalis

Based on studies in:
USA: Alabama (Plant substrate, Treeholes)

This list may not be complete but is based on published studies.
  • R. L. Kitching and S. L. Pimm, 1988. The length of food chains: phytotelmata in Australia and elsewhere. Proc. Ecol. Soc. Aust. 14:123-140, from p. 134 (from W. E. Snow, 1958, Stratification of arthropods in a wet stump cavity. Ecology 39(1):83-88, fr
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aedes triseriatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAATTTGATCAGGAANAGNNNGNACATCATTAAGAATTTTAGTTCGTGCCGAACTAAGCCAACCAGGAATATTTATTGGAAATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTCTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTCTGAATATTACCCCCTTCTTTAACTTTACTCCTTTCGAGTAGTATGGTAGAAAATGGGTCAGGAACAGGTTGAACCGTTTATCCCCCACTTTCATCTGGAACAGCCCATGCCGGAGCTTCAGTTGATTTAACAATTTTTTCCCTTCATTTAGCGGGAGTATCTTCAATTTTAGGAGCAGTAAATTTTATTACTACTGTTATTAATATACGATCATCAGGAATTACTTTAGATCGATTACCTTTATTCGTTTGATCTGTTGTAATTACAGCAATTTTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCTTTCTTTGATCCTATTGGAGGAGGAGACCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aedes triseriatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ochlerotatus triseriatus

Ochlerotatus triseriatus is also known by the synonym Aedes triseriatus and is a member of the true fly family. This species is a tree hole breeding mosquito in eastern North America. It is a known vector of La Crosse Encephalitis


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!