Articles on this page are available in 1 other language: Arabic (10) (learn more)

Overview

Brief Summary

Aedes aegypti, the yellow fever mosquito, is a dangerous vector of the dengue fever, Chikungunya and yellow fever viruses, and other diseases. This small mosquito has white and black stripes on its body and legs and a marking in the form of a lyre on the thorax. The mosquito originated in Africa but is now found in tropical and subtropical regions throughout the world. Only the female bites mammal hosts for blood, which she needs to mature her eggs. The CDC traveler's page on preventing dengue fever suggests using mosquito repellents that contain DEET (N, N-diethylmetatoluamide, between 20% to 30% concentration, but not more), and also suggests care be taken to wear thick, long-sleeved clothing, mosquito nettings over the bed, and spraying with the insecticide permethrin. The genome of Aedes aegypti was the second mosquito genus to be sequenced in full, in 2007. The genus Aedes is undergoing reorganization according to recent morphological analyses by Reinert et al. This would change the name of Aedes aegypti to Stegomyia aegypti. Because this species is of great medical and public health importance, this proposed name change is very controversial and some scientists are choosing to ignore the reclassification; at least one scientific journal, the Journal of Medical Entomology, has officially encouraged authors dealing with mosquitoes in the subfamily Aedinae to continue to use the traditional names unless they have particular reasons for doing so. (Editors of The Journal of Medical Entomology; Polaszek 2006; Weaver 2005; Wikipedia 2011; Wikipedia 2011b; WRBU)

  • Editors of The Journal of Medical Entomology. Policy on Names of Aedine Mosquito Genera and Subgenera. Entomological Society of America. Retrieved November 16, 2011 from http://www.entsoc.org/Pubs/Periodicals/JME/mosquito_name_policy
  • Nene, V.; Wortman, J. R.; Lawson, D.; et al., B; Kodira, C; Tu, ZJ; Loftus, B; Xi, Z et al. June 2007. Genome sequence of Aedes aegypti, a major arbovirus vector. Science 316 (5832): 1718–1723. doi:10.1126/science.1138878.
  • Polaszek A., 2006. Two words colliding: resistance to changes in the scientific names of animals–Aedes vs Stegomyia. Trends in Parasitology 22 (1): 8–9. doi:10.1016/j.pt.2005.11.003. PMID 16300998.
  • Reinert J.F., R.E. Harback, and I.J. Kitching, 2004. Phylogeny and classification of Aedini (Diptera: Culicidae), based on morphological characters of all life stages. Zoological Journal of the Linnean Society 142 (3): 289–368. doi:10.1111/j.1096-3642.2004.00144.x.
  • Reinert, J.F., Harbach, R.E. & Kitching, I.J. 2009. Phylogeny and classification of Aedini (Diptera: Culicidae). Zoological Journal of the Linnean Society 157, 700−794.
  • Weaver, S. 2005. Journal policy on names of aedine mosquito genera and subgenera. Am. J. Trop. Med. Hyg., 73(3), 2005, p. 481
  • Wikipedia, The Free Encyclopedia. 19 October 2011. “Aedes". Retrieved November 15, 2011 from http://en.wikipedia.org/w/index.php?title=Aedes&oldid=456322788
  • Wikipedia, The Free Encyclopedia. 9 November 2011. “Aedes aegypti". Retrieved November 15, 2011 from http://en.wikipedia.org/w/index.php?title=Aedes_aegypti&oldid=459865222
  • WRBU (Walter Reed Biosystematics Unit). Aedes. Retrieved November 16, 2011 from http://wrbu.si.edu/generapages/aedes.htm
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Original Description

(Linnaeus) 1762:470 (A; Culex)

Walter Reed Biosystematics Unit

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Albania, Angola, Argentina, Bangladesh, Bosnia and Herzegovina, Botswana, Cambodia, Cameroon, Comoros, Cook Islands , Cosmotropical (within the 20o C. isotherms), Cote d'Ivoire, Djibouti, Dominican Republic, Egypt, Equatorial Guinea, Ethiopia, Fiji, Ghana, Greece, India, Indonesia, Japan, Kenya, Kiribati, Laos, Macedonia, Madagascar, Malaysia, Maldives, Marshall Islands, Mauritius, Micronesia, Federated States of, Morocco, Myanmar (Burma), Namibia, Nauru, New Caledonia, Nigeria, Papua New Guinea, Philippines, Samoa, Senegal, Sierra Leone, Solomon Islands, South Africa, Sudan, Tanzania, Thailand, Tonga, Trinidad and Tobago, Tuvalu, United States, Uruguay, Vanuatu, Zaire, Zambia

Walter Reed Biosystematics Unit

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution Map

Walter Reed Biosystematics Unit

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

In association with man, aegypti will use any and all natural and artifical containers. Away from urban areas the species tends to favor pools in river beds, tree stumps, tree holes and natural containers. Females are primarily day biters and readily enter buildings to feed. They have also been taken in lesser numbers at night (Christophers 1960).

Walter Reed Biosystematics Unit

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aedes aegypti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCGCGACAATGGTTATTTTCAACAAATCATAAAGATATTGGAACTTTATATTTCATTTTTGGAGTATGATCTGGAATAGTCGGAACTTCTCTAAGAATTTTAATTCGTGCTGAACTTAGCCACCCTGGTATATTTATTGGGAATGACCAAATTTATAATGTAATTGTAACAGCTCATGCATTTATTATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATGAATAATATAAGTTTTTGAATACTACCTCCTTCATTGACTCTTCTATTATCAAGCTCAATAGTAGAAAATGGGGCAGGAACTGGGTGAACAGTTTATCCTCCTCTCTCTTCAGGAACAGCTCATGCTGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCCTCAATTTTAGGGGCAGTAAATTTTATTACAACTGTGATTAATATGTGATCGTCAGGGATTACTTTAGATCGACTACCCTTATTTGTTTGATCTGTAGTTATTACAGCTATCTTATTACTTCTTTCTCTTCCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGACCGAAACTTAAATACATCTTTCTTTGATCCAATCGGAGGGGGAGACCCTATTTTATACCAACACTTATTTTGATTCTTTGGACACCCAGAAGTTTATATTTTAATTTTACCCGGATTTGGAATAATTTCTCATATTATTACTCAAGAAAGCGGAAAAAAGGAAACATTTGGAACTTTAGGAATAATTTATGCTATATTAACAATTGGATTATTGGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGTATAGACGTAGATACTCGAGCTTATTTTACTTCAGCAACTATAATTATTGCTGTTCCTACAGGAATTAAAATTTTTAGTTGATTAGCAACTTTACACGGAACTCAATTAACATATAGTCCAGCCCTTCTATGATCATTAGGATTTGTATTTTTATTTACAGTTGGAGGTTTAACAGGAGTAGTATTAGCTAATTCTTCAATTGATATTGTTCTTCATGATACTTATTACGTAGTTGCCCATTTTCATTACGTTTTATCTATAGGAGCTGTATTTGCTATTATAGCAGGATTTATTCATTGATACCCTTTATTAACAGGAATAGTTATAAACCCTTCATGATTAAAGGCTCAATTTAGTATAATATTTATTGGAGTAAATCTAACTTTCTTTCCTCAACATTTTTTAGGGTTAGCTGGAATACCTCGACGATACTCAGATTTTCCTGATAGCTACTTAACTTGAAATATTATTTCTTCTTTAGGAAGAACAATTTCACTATTTGCCGTTATTTTCTTTTTATTTATTATTTGAGAAAGTATAATTACTCAACGAACACCTTCTTTCCCTATACAATTATCTTCATCTATTGAATGATATCATACACTTCCTCCTGCAGAACATACTTATTCAGAATTACCACTACTTTCTTCTAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aedes aegypti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 75
Specimens with Barcodes: 154
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stegomyia aegypti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 95
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Toxicity, Symptoms and Treatment

Primary vector of dengue and yellow fever (Christophers 1960).

Walter Reed Biosystematics Unit

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Aedes aegypti

The yellow fever mosquito, Aedes aegypti is a mosquito that can spread the dengue fever, chikungunya and yellow fever viruses, and other diseases. The mosquito can be recognized by white markings on legs and a marking in the form of a lyre on the thorax. The mosquito originated in Africa[2] but is now found in tropical and subtropical regions throughout the world.[3]

Contents

Spread of disease and prevention [edit]

Aedes aegypti is a vector for transmitting several tropical fevers. Only the female bites for blood which she needs to mature her eggs. Understanding how the mosquito detects its host is a crucial step in the spread of the disease. Aedes aegypti are attracted to chemical compounds that are emitted by mammals. These compounds include ammonia, carbon dioxide, lactic acid, and octenol. Scientists at the Agricultural Research Service have studied the specific chemical structure of octenol in order to better understand why this chemical attracts the mosquito to its host.[4] They found that the mosquito has a preference for "right-handed" (dextrorotatory) octenol molecules.

Aedes aegypti can also contribute to spread reticulum cell sarcoma among Syrian hamsters[5].

The CDC traveler's page on preventing dengue fever suggests using mosquito repellents that contain DEET (N, N-diethylmetatoluamide, 20% to 30% concentration, but not more). It also suggests the following:

  1. Although aedes aegypti mosquitoes most commonly bite at dusk and dawn, indoors, in shady areas, or when the weather is cloudy, "they can bite and spread infection all year long and at any time of day."[6][7]
  2. The mosquito's preferred breeding areas are in areas of stagnant water, such as flower vases, uncovered barrels, buckets, and discarded tires, but the most dangerous areas are wet shower floors and toilet tanks, as they allow the mosquitos to breed in the residence. Research has shown that certain chemicals emanating from bacteria in water containers stimulate the female mosquitoes to lay their eggs. They are particularly motivated to lay eggs in water containers that have the correct amounts of specific fatty acids associated with bacteria involved in the degradation of leaves and other organic matter in water. The chemicals associated with the microbial stew are far more stimulating to discerning female mosquitoes than plain or filtered water in which the bacteria once lived.[8]
  3. Wear long-sleeved clothing and long trousers when outdoors during the day and evening.
  4. Spray permethrin or DEET repellents on clothing, as mosquitos may bite through thin clothing.
  5. Use mosquito netting over the bed if the bedroom is not air conditioned or screened. For additional protection, treat the mosquito netting with the insecticide permethrin.
  6. Spray permethrin or a similar insecticide in the bedroom before retiring.

Although the lifespan of an adult Aedes aegypti is two to four weeks depending on conditions,[9] the eggs can be viable for over a year in a dry state, which allows the mosquito to re-emerge after a cold winter or dry spell.[10]

Genetic modification [edit]

A. aegypti is the subject of investigations that genetically modify the mosquitoes. The modified strain, known as OX513A,[11] requires the antibiotic tetracycline to develop beyond the larval stage and passes this trait onto offspring. Modified males raised in a laboratory will develop normally as they are supplied with this chemical and can be released into the wild. However, their subsequent offspring will find no tetracycline in their environment and will never develop into adults.[12] An Oxford firm, Oxitec, is performing a pilot program in Juazeiro, Brazil to test the effectiveness of these modifications in reducing disease spread.[11] A 2010 study carried one in the Cayman Islands saw the release of over three million OX513A mosquitoes. The wild population of mosquitoes subsequently dropped by 80%.[11]

Genomics [edit]

Male (left) and female (centre and right) Aedes aegypti

The genome of this species of mosquito was sequenced and analyzed by a consortium including scientists at The Institute for Genomic Research (now part of the J. Craig Venter Institute), the European Bioinformatics Institute, the Broad Institute, and the University of Notre Dame, and published in 2007. The effort in sequencing its DNA was intended to provide new avenues for research into insecticides and possible genetic modification to prevent the spread of virus. This was the second mosquito species to have its genome sequenced in full (the first was Anopheles gambiae). The published data included the 1.38 billion base pairs containing the insect's estimated 15,419 protein encoding genes. The sequence indicates that the species diverged from Drosophila melanogaster (the common fruit fly) about 250 million years ago, and that Anopheles gambiae and this species diverged about 150 million years ago.[13][14]

Scientific name [edit]

The species was first named (as Culex aegypti) in a 1757 publication by Fredric Hasselquist titled Iter Palaestinum ("A Journey to Palestine"). Hasselquist was provided with the names and descriptions by his mentor, Carl Linnaeus. Iter Palaestinum was later translated into German and published in 1762 as Reise nach Palästina. Since the latter is an uncritical reproduction of the former, they are both considered to pre-date the starting point for zoological nomenclature in 1758. Nonetheless, the name Aedes aegypti was frequently used, starting with H. G. Dyar in 1920.

A. aegypti feeding on a human.

In order to stabilise the nomenclature, a petition to the International Commission on Zoological Nomenclature was made by P. F. Mattingly, Alan Stone and Kenneth L. Knight in 1962.[15] It also transpired that, although the name Aedes aegypti was universally used for the yellow fever mosquito, Linnaeus had actually described a species now known as Aedes (Ochlerotatus) caspius.[15] In 1964, the commission ruled in favour of the proposal, validating Linnaeus' name, and transferring it to the species for which it was in general use.[16]

The yellow fever mosquito belongs to the tribe Aedini of the dipteran family Culicidae and to the genus Aedes and subgenus Stegomyia. According to one recent analysis, the subgenus Stegomyia of the genus Aedes should be raised to the level of genus.[17] The proposed name change has been ignored by most scientists;[18] at least one scientific journal, the Journal of Medical Entomology, has officially encouraged authors dealing with aedine mosquitoes to continue to use the traditional names, unless they have particular reasons for not doing so.[19]

See also [edit]

References [edit]

  1. ^ a b Neal L. Evenhuis & Samuel M. Gon III (2007). "22. Family Culicidae" (PDF). In Neal L. Evenhuis. Catalog of the Diptera of the Australasian and Oceanian Regions. Bishop Museum. pp. 191–218. Retrieved February 4, 2012. 
  2. ^ Laurence Mousson, Catherine Dauga, Thomas Garrigues, Francis Schaffner, Marie Vazeille & Anna-Bella Failloux (August 2005). "Phylogeography of Aedes (Stegomyia) aegypti (L.) and Aedes (Stegomyia) albopictus (Skuse) (Diptera: Culicidae) based on mitochondrial DNA variations". Genetics Research 86 (1): 1–11. doi:10.1017/S0016672305007627. PMID 16181519. 
  3. ^ M. Womack (1993). "The yellow fever mosquito, Aedes aegypti". Wing Beats 5 (4): 4. 
  4. ^ Dennis O'Brien (March 9, 2010). "ARS Study Provides a Better Understanding of How Mosquitoes Find a Host". U.S. Department of Agriculture. Archived from the original on 8 October 2010. Retrieved 2010-08-27. 
  5. ^ Banfield, William G.; Woke, P. A.; MacKay, C. M.; Cooper, H. L. (28 May 1965). "Mosquito Transmission of a Reticulum Cell Sarcoma of Hamsters". Science 148 (3674): 1239–1240. doi:10.1126/science.148.3674.1239. PMID 14280009. 
  6. ^ "Travelers' Health Outbreak Notice". Centers for Disease Control and Prevention. June 02, 2010. Archived from the original on 26 August 2010. Retrieved 2010-08-27. 
  7. ^ "Dengue Virus: Vector And Transmission". Retrieved 19 October 2012. 
  8. ^ "Lay Your Eggs Here". Newswise, Inc. 07-03-2008. Retrieved 2010-08-27. 
  9. ^ Catherine Zettel & Phillip Kaufman. "Yellow fever mosquito Aedes aegypti". University of Florida, Institute of Food and Agricultural Sciences. Retrieved 2010-08-27. 
  10. ^ Roland Mortimer. "Aedes aegypti and Dengue fever". Onview.net Ltd, Microscopy-UK. Retrieved 2010-08-27. 
  11. ^ a b c Michael Specter, "The Mosquito Solution", The New Yorker, July 9-16, 2012, page 38.
  12. ^ Conal Urquhart (15 July 2012). "Can GM mosquitoes rid the world of a major killer?". The Observer. Retrieved 2012-07-15. 
  13. ^ Heather Kowalski (May 17, 2007). "Scientists at J. Craig Venter Institute publish draft genome sequence from Aedes aegypti, mosquito responsible for yellow fever, dengue fever". J. Craig Venter Institute. 
  14. ^ Vishvanath Nene, Jennifer R. Wortman, Daniel Lawson, Brian Haas, Chinnappa Kodira et al. (June 2007). "Genome sequence of Aedes aegypti, a major arbovirus vector". Science 316 (5832): 1718–1723. Bibcode:2007Sci...316.1718N. doi:10.1126/science.1138878. PMC 2868357. PMID 17510324. 
  15. ^ a b P. F. Mattingly, Alan Stone & Kenneth L. Knight (1962). "Culex aegypti Linnaeus, 1762 (Insecta, Diptera); proposed validation and interpretation under the plenary powers of the species so named. Z.N.(S.) 1216" (PDF). Bulletin of Zoological Nomenclature 19 (4): 208–219. 
  16. ^ International Commission on Zoological Nomenclature (1964). "Culex aegypti Linnaeus, 1762 (Insecta, Diptera): validated and interpreted under the plenary powers". Bulletin of Zoological Nomenclature 21 (4): 246–248. 
  17. ^ John F. Reinert, Ralph E. Harbach & Ian J. Kitching (2004). "Phylogeny and classification of Aedini (Diptera: Culicidae), based on morphological characters of all life stages" (PDF). Zoological Journal of the Linnean Society 142 (3): 289–368. doi:10.1111/j.1096-3642.2004.00144.x. 
  18. ^ Andrew Polaszek (January 2006). "Two words colliding: resistance to changes in the scientific names of animals – Aedes vs Stegomyia". Trends in Parasitology 22 (1): 8–9. doi:10.1016/j.pt.2005.11.003. PMID 16300998. 
  19. ^ "Journal of Medical Entomology Policy on Names of Aedine Mosquito Genera and Subgenera". Entomological Society of America. Retrieved August 31, 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

References and More Information

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!