Overview

Brief Summary

 This species is the primary vector of several arboviral diseases in the Southern United States, most particularly West Nile virus, and fiariasis in India. It is a strong-winged domestic species seen all over India in and around human dwellings. Rapid urbanization and industrialization without adequate drainage facilities are responsible for its increased dispersal. Upon emergence, adult females prefer obtaining blood from birds, but as they age, the species is highly anthropophilic (they prefer human blood). They enter the houses at dusk and reach maximum density by midnight. The peak biting time is at midnight. Legs, particularly below the knee, are the preferred biting sites. During the day, it may be seen resting indoors on walls, underneath furniture, hanging cloths in dark corners, or in closets/wardrobes/cupboards. (Wikipedia 2012)

  • Wikipedia contributors. "Culex quinquefasciatus." Wikipedia, The Free Encyclopedia. Wikipedia, The Free Encyclopedia, 25 Sep. 2012. Web. 25 Sep. 2012.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia editors and contributors

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Culex quinquefasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 36 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCGCGACAATGACTATTCTCTACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGGGCTTGAGCTGGAATAGTTGGAACTTCTTTAAGTTTACTAATTCGAGCAGAATTAAGTCAACCAGGTGTATTTATTGGAAATGATCAAATTTATAATGTTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATGTTAGGAGCTCCAGATATGGCCTTTCCTCGAATAAATAATATAAGTTTTTGAATACTACCTCCTTCATTGACACTACTACTTTCAAGTAGTTTAGTAGAAAATGGAGCTGGGACTGGATGAACAGTGTATCCCCCTCTTTCATCTGGAACAGCTCATGCTGGAGCTTCAGTAGACTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGTGCAGTAAATTTTATTACAACAGTAATTAATATACGATCTTCAGGAATTACTCTTGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACTGCAGTTTTATTACTTCTTTCTTTACCTGTTTTAGCTGGTGCTATTACTATGTTATTAACAGATCGAAATTTAAATACTTCATTCTTTGATCCAATTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTCTTTGGACATCCAGAAGTTTATATTTTAATTCTTCCAGGGTTTGGAATAATTTCTCATATTATTACTCAAGAAAGAGGAAAAAAGGAAACATTTGGAACTTTAGGAATAATTTATGCTATATTAGCTATTGGTTTATTAGGGTTTATTGTTTGAGCTCATCATATATTTACAGTTGGAATAGATGTTGATACACGAGCTTATTTTACATCTGCTACAATAATTATTGCTGTACCAACAGGAATTAAAATTTTCAGTTGATTAGCTACTCTTCATGGAACACAATTAAACTATACACCTGCTTTATTATGATCATTAGGATTTGTATTTTTATTTACTGTTGGAGGATTAACAGGAGTTGTATTAGCTAATTCTTCTATTGATATTGTTCTTCATGATACATATTATGTTGTTGCTCATTTCCATTATGTATTATCTATAGGAGCTGTATTTGCTATTATAGCAGGATTTATTCACTGATATCCTTTATTAACAGGATTAGTAATAAACCCTACATGATTAAAGATTCAATTTACTATTATATTTATTGGAGTAAATTTAACATTTTTCCCACAACATTTCTTAGGATTAGCAGGAATACCACGACGATATTCTGATTTTCCAGATAGTTACTTAGCATGAAATATTGTTTCATCATTAGGTAGAACAATTTCATTATTTGGAATTGTATTCTTTTTATTTATTATTTGAGAAAGTATAATTTCTCAACGAACACCTTCATTCCCTATACAATTATCATCATCAATTGAATGATATCATACTCTTCCACCTGCAGAACATACATATGCAGAACTTCCATTATTATCATCTAATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Culex quinquefasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 68
Specimens with Barcodes: 1194
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Culex quinquefasciatus

Culex quinquefasciatus (earlier known as Culex fatigans), the southern house mosquito, is a medium-sized mosquito found in tropical and subtropical regions of the world. It is the vector of Wuchereria bancrofti, avian malaria, and arboviruses including St. Louis encephalitis virus, Western equine encephalitis virus, and West Nile virus.[1] It is taxonomically regarded as a member of the Culex pipiens species complex.[2] Its genome was sequenced in 2010, and was shown to have 18,883 protein-coding genes.[3]

Description[edit]

Adult C. quinquefasciatus is a medium-sized mosquito and is brown in colour. The body is about 3.96 to 4.25 mm long. While the main body is brown, the proboscis, thorax, wings, and tarsi are darker than the rest of the body. The head is light brown with the lightest portion in the center. The antennae and the proboscis are about the same length, but in some cases, the antennae are slightly shorter than the proboscis. The flagellum has 13 segments that may have few or no scales. The scales of the thorax are narrow and curved. The abdomen has pale, narrow, rounded bands on the basal side of each tergite. Males can be differentiated from females in having large palps and feathery antennae.[4]

The larva has a short and stout head. The mouth brushes have long yellow filaments used for filtering organic materials. The abdomen consists of eight segments, the siphon, and the saddle. Each segment has a unique setae pattern. The siphon is on the dorsal side of the abdomen, and is four times longer than its breadth. The siphon has multiple setae tufts. The saddle is barrel-shaped and located on the ventral side of the abdomen with four long anal papillae protruding from the posterior end.[1]

Lifecycle[edit]

Mature C. quinquefasciatus females fly at night to nutrient-rich standing water to lay eggs. The larvae feed on organic material in the water and require between five to eight days to complete their development at 30°C. The larvae pass through four larval instars, and towards the end of the fourth instar, they stop eating and undergo moulting to give rise to pupae. After 36 hours at 27°C, adults emerge. The exact timing of development can vary depending on temperature. Both males and females take sugar meals from plants. But after mating, the female seeks a blood meal on mammals and birds. Ingested blood is necessary for egg development. A single female can lay up to five rafts of eggs in a lifetime, with each raft containing thousands of eggs. The exact number varies depending on climatic conditions.[1]

As a vector[edit]

The southern house mosquito can transmit zoonotic diseases that affect humans and wild and domestic animals, such as lymphatic filariasis, avian malaria, St. Louis encephalitis, Western equine encephalitis, and West Nile fever. It causes infection through biting during blood meal. In the southern U.S., it is the primary vector of St. Louis encephalitis virus. In India and Southeast Asia, it is the primary vector of Wuchereria bancrofti, a nematode that causes lymphatic filariasis. It acts as an intermediate host for the helminth parasite by harbouring the larval stages.[5] It also transmits Plasmodium relictum, a malarial parasite of birds, and is the principal vector in Hawaii. It is the definitive host for malarial parasite as it harbours the sexual cycle.[6]

Bionomics[edit]

It breeds profusely in dirty water collections, including stagnant drains, cesspools, septic tanks with leaks, burrow pits, and almost all organic polluted water collections. In optimum temperature and humidity, the lifecycle will be completed in seven days, passing through the egg, larval, pupal, and adult stages.

References[edit]

  1. ^ a b c Hill, Stephanie; Connelly, Roxanne (2009). "Features Creatures: Southern house mosquito". University of Florida. Retrieved 19 March 2014. 
  2. ^ Turell, MJ (2012). "Members of the Culex pipiens complex as vectors of viruses". Journal of the American Mosquito Control Association 28 (4 Suppl): 123–6. PMID 23401952. 
  3. ^ Arensburger, P.; Megy, K.; Waterhouse, R. M.; Abrudan, J.; Amedeo, P.; Antelo, B.; Bartholomay, L.; Bidwell, S.; Caler, E.; Camara, F.; Campbell, C. L.; Campbell, K. S.; Casola, C.; Castro, M. T.; Chandramouliswaran, I.; Chapman, S. B.; Christley, S.; Costas, J.; Eisenstadt, E.; Feschotte, C.; Fraser-Liggett, C.; Guigo, R.; Haas, B.; Hammond, M.; Hansson, B. S.; Hemingway, J.; Hill, S. R.; Howarth, C.; Ignell, R.; Kennedy, R. C.; Kodira, C. D.; Lobo, N. F.; Mao, C.; Mayhew, G.; Michel, K.; Mori, A.; Liu, N.; Naveira, H.; Nene, V.; Nguyen, N.; Pearson, M. D.; Pritham, E. J.; Puiu, D.; Qi, Y.; Ranson, H.; Ribeiro, J. M. C.; Roberston, H. M.; Severson, D. W.; Shumway, M.; Stanke, M.; Strausberg, R. L.; Sun, C.; Sutton, G.; Tu, Z.; Tubio, J. M. C.; Unger, M. F.; Vanlandingham, D. L.; Vilella, A. J.; White, O.; White, J. R.; Wondji, C. S.; Wortman, J.; Zdobnov, E. M.; Birren, B.; Christensen, B. M.; Collins, F. H.; Cornel, A.; Dimopoulos, G.; Hannick, L. I.; Higgs, S.; Lanzaro, G. C.; Lawson, D.; Lee, N. H.; Muskavitch, M. A. T.; Raikhel, A. S.; Atkinson, P. W. (2010). "Sequencing of Culex quinquefasciatus Establishes a Platform for Mosquito Comparative Genomics". Science 330 (6000): 86–88. doi:10.1126/science.1191864. PMC 3740384. PMID 20929810. 
  4. ^ "Brown House Mosquito (Culex quinquefasciatus)". OzAnimals.com. Retrieved 19 March 2014. 
  5. ^ Albuquerque, Cleide MR; Cavalcanti, Vânia MS; Melo, Maria Alice V; Verçosa, Paulo; Regis, Lêda N; Hurd, Hilary (1999). "Bloodmeal microfilariae density and the uptake and establishment of Wuchereria bancrofti infections in Culex quinquefasciatus and Aedes aegypti". Memórias do Instituto Oswaldo Cruz 94 (5): 591–596. doi:10.1590/S0074-02761999000500005. PMID 10464399. 
  6. ^ Farajollahi, Ary; Fonseca, Dina M.; Kramer, Laura D.; Marm Kilpatrick, A. (October 2011). ""Bird biting" mosquitoes and human disease: A review of the role of Culex pipiens complex mosquitoes in epidemiology". Infection, Genetics and Evolution 11 (7): 1577–1585. doi:10.1016/j.meegid.2011.08.013. PMC 3190018. PMID 21875691. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!