Articles on this page are available in 1 other language: Arabic (13) (learn more)

Overview

Distribution

Geographic Range

Culex tarsalis is a North American species of mosquito that occupies a large swath of territory between northern Mexico and southern Canada, spreading from the Pacific to the Atlantic coast. It is most commonly seen in California, at elevations ranging as high as 3000 meters. The species is much less abundant in areas east of the Mississippi River, although there have been several reported cases of C. tarsalis occurrences as far as New Jersey, which were found exploiting freshwater impoundments constructed to eliminate the salt marsh species Aedes sollicitans.

Biogeographic Regions: nearctic (Native )

  • Crans, W., L. McCuiston. 1987. Rare New Jersey mosquito species collected in 1986. Proc. N. J. Mosquito Control Assoc., p: 89-94.
  • Reisen, W. 1993. The Western Encephalitis mosquito, Culex tarsalis. Wing Beats, 4 (2): 16.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Culex tarsalis is a black mosquito distinguished by a white band on its proboscis, as well as white bands on its tarsal joints. It also has white longitudinal stripes extending along the middle and hind legs, and dark chevron patterns along the underside of its abdominal segments.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

This species can be found in almost every environment in the U.S. The spread of C. tarsalis across the U.S. has been facilitated by human activity, with irrigation making formerly inhospitable arid regions available for breeding, which can occur in any sunlit standing freshwater. The species has been found at elevations ranging from sea level to over 3000 meters. Larval habitats are often shared with Culiseta inornata, Culex quinquefasciatus, Culex salinarius, Culex pipiens, and Culex stigmatosoma, as well as a number of species of Aedes and Anopheles. Although a widespread and hardy species, C. tarsalis was not able to establish a large presence in the Northeast due to competition from C. salinarius.

Range elevation: 0 to 3000 m.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: savanna or grassland ; forest ; mountains

Aquatic Biomes: lakes and ponds

Other Habitat Features: agricultural

  • Rejmankova, E., M. Rejmanek, M. Pitcairn, R. Washino. 1988. Aquatic vegetation in rice fields as a habitat for Culex tarsalis and Anopheles freeborni. Proceedings and papers of the annual conference of the California Mosquito and Vector Control Association, 56: 160-163.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Culex tarsalis exhibits relatively generalized (catholic) blood feeding patterns, feeding on both birds and mammals, depending on host availability and distribution. When populations are low in the spring, most females tend to feed on birds. In the late summer when abundances are higher, birds will learn to avoid these mosquitoes, causing C. tarsalis to seek mammalian hosts, including rabbits, horses, cattle, and humans. This seasonal shift may be a significant factor in zoonotic viral transmission. In general, C. tarsalis shows a preference for bird hosts over mammals at a ratio of approximately 3:1.

Both sexes also feed on nectar and plant fluids.

Animal Foods: blood

Plant Foods: nectar; sap or other plant fluids

Primary Diet: carnivore (Sanguivore ); herbivore (Nectarivore )

  • Wekesa, J., B. Yuval, R. Washino, A. Vasquez. 1997. Blood feeding patterns of Anopheles freeborni and Culex tarsalis (Diptera: Culicidae): effects of habitat and host abundance. Bulletin of Entomological Research, 87: 633-641.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

These mosquitoes transmit St. Louis Encephalitis and Western Equine Encephalitis. They are a nuisance to many species of birds and mammals. They also may be prey for birds and bats. Because adults eat nectar, they may pollinate some plant species.

Ecosystem Impact: pollinates; parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Bats and birds are known to eat mosquitoes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

These mosquitoes find hosts by detecting the sweat and carbon dioxide exhaled by mammamls or birds.

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Developmental periods range from 7 days to almost four weeks, depending upon temperature and food availability. Larvea and pupae live in the water, and emerge as adults into the air.

Development - Life Cycle: metamorphosis

  • Walton, W., N. Tietze, M. Mulla. 1990. Ecology of Culex tarsalis (Diptera: Culicidae): factors influencing larval abundance in mesocosms in southern California. Journal of Medical Entomology, 27: 57-67.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females oviposit egg rafts conataining an avaerage of about 190 eggs in newly flooded, freshwater substrates, larvae exploiting microfloral blooms produced by the release of nutrients from decomposing vegetation. It was found that larval populations declined markedly 2-3 weeks after habitat flooding due to a reduction in these blooms. Typical developmental sites vary in size from small man-made containers to large ponds. In general, C. tarsalis will breed in water in any sunny location, and will tolerate a wide range of water conditions. Developmental periods range from 7 days to almost four weeks, depending upon temperature and food availability. Females spend the winter carrying inseminated nullipars (undeveloped eggs) which require a blood meal to mature in the spring. However, in a phenomenon termed autogeny, some females are able to mature their initial egg batch without a blood meal, and oviposit 4-5 days after emergence.

Females lay eggs in a "raft" that floats on top of the water. Each raft contains about 190 eggs. Females prefer to lay their eggs in newly flooded areas, so nutrients are available for larvae to eat. Females will lay their eggs in all types of wet areas, from small containers of standing water to large ponds. Females spend the winter carrying undeveloped eggs. Once they feed on blood the next spring, their eggs can finish developing, and can be laid.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Beyond developing eggs, and laying them in an appropriate habitat, females do not provide parental care.

Parental Investment: pre-fertilization (Provisioning)

  • Reisen, W. 1993. The Western Encephalitis mosquito, Culex tarsalis. Wing Beats, 4 (2): 16.
  • Walton, W., N. Tietze, M. Mulla. 1990. Ecology of Culex tarsalis (Diptera: Culicidae): factors influencing larval abundance in mesocosms in southern California. Journal of Medical Entomology, 27: 57-67.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Culex tarsalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGGGCTTGAGCTGGAATAATTGGTACTTCATTAAGTATTCTTATTCGAGCAGAATTAAGTCAACCTGGAGTATTTATTGGAAATGATCAAATTTATAATGTTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGAATACTACCTCCTTCATTAACACTACTACTTTCAAGTAGTATAGTGGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCTGGTACAGCCCATGCTGGAGCTTCAGTAGATTTAGCTATTTTTTCGTTACATTTAGCTGGTATTTCATCAATTTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCTTCAGGTATTACTCTTGATCGAATACCATTATTTGTTTGATCAGTAGTAATTACTGCTGTTCTTTTACTTCTTTCTTTACCTGTATTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCAATTGGAGGAGGAGACCCAATTTTATATCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Culex tarsalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 39
Specimens with Barcodes: 64
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

This species is extremely abundant in many places and in no need of special protections.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Culex tarsalis is one of the most important vectors of arboviruses in North America, most noted for the transmission of St. Louis Encephalitis (SLE) and Western Equine Encephalitis (WEE). Both are zoonotic diseases maintained in natural bird reservoirs. Some mammals, particularly jackrabbits, may be involved in transmission cycles in certain areas. SLE, sometimes called "sleeping sickness" or "summer flu," is associated with aseptic meningitis and inflammation of brain tissue and can be fatal in humans, usually among children or the elderly, with a mortality rate of up to 23%. WEE is less virulent in humans, with a mortality rate of about 4%; however, it is a serious disease in horses and can impose a heavy economic cost in lost livestock and vaccination and mosquito control programs. Human infections are most common in the warmer months, especially toward the end of summer as C. tarsalis begins to seek mammalian hosts. Transmission rates are also affected by temperature.

Culex tarsalis has also been observed to be a vector for the Llano Seco, Turlock, Gay Lodge, and Hart Park viruses, as well as several species of avian malaria. In laboratory experiments, C. tarsalis was found to be a competent vector of Japanese and Venezuelan Equine Encephalitis viruses.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

  • Noden, B., C. Pumpuni, J. Vaughan, J. Beier. 1995. Noninfectious sporozoites in the salivary glands of a minimally susceptible anopheline mosquito. Journal of Parasitology, 81: 912-915.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Risk Statement

West Nile virus (WNV) spread rapidly across the western United States between the years 2001 and 2004. This westward movement is generally believed to have been mediated by random dispersive movements of resident birds. Little attention has been focused on the possible role of mosquito vectors in dispersing the virus across North America. The mosquito vector largely responsible for WNV amplification and transmission in the western United States is Culex tarsalis. Venkatesan and Rasgon (2010) studied the genetic population structure of C. tarsalis across its range in the United States and used these data to infer patterns of gene flow and dispersal. Gene flow appeared to be relatively unobstructed over large portions of the West Coast and within the Great Plains region. The pattern of genetic clustering in C. tarsalis is congruent with the pattern of invasion of WNV across the western United States, suggesting that movement of this mosquito may be involved in dispersal of WNV. Mosquito movements may occur not only by normal flight, but also mediated by humans and weather patterns. Along with C. tarsalis, C. quinquefasciatus is a major vector of WNV in the western United States, especially in residential areas. Studies in California have shown that C. quinquefasciatus may move several kilometres and travel between riparian and urban habitats, at times moving even farther than C. tarsalis. Together, these and other mosquitos may have played an important role in moving WNV across North America. (Venkatesan and Rasgon 2010)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!