Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhagio mystaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCGCGACAATGATTATTTTCAACAAATCATAAAGATATTGGAACTCTATACTTTATTTTTGGTGCTTGAGCTGGAATAGTAGGAACATCCCTAAGTATATTGATTCGAGCAGAATTAGGACACCCAGGTGCTTTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCCCATGCTTTTGTTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCAGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGATTATTGCCCCCATCATTAACTTTATTATTATCCAGAAGTATAGTGGAAACTGGAGCAGGAACTGGATGAACTGTTTATCCTCCTCTATCATCTTCTATTGCACATGGAGGAGCCTCAGTTGACCTAGCAATTTTTTCCCTTCACTTAGCTGGTGTATCTTCTATTTTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGATCAACAGGTATTACTTTTGATCGAATACCTTTATTTGTATGAGCTGTAGTAATTACTGCTATTTTATTACTTCTATCTTTACCAGTATTAGCTGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCAGCCGGGGGAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhagio mystaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rhagio mystaceus

Rhagio mystaceus, also known as the down-looker fly, downlooker snipefly[3] and common snipe fly,[4][5][6] is a species of flies from the family Rhagionidae.[7]

Description[edit]

Rhagio mystaceus has an overall dark colour, with males growing to 7-9 mm, and females reaching 6-8 mm. The thorax has three dark dorsal stripes. Normally, the center stripe has a very thin, pale line running down the middle. On the abdomen, there are yellowish rings at the posterior of the segments. However, the basal segment on some specimens are mostly yellowish and have a black dorsal and lateral spot.[8]

The wing are patterned with dark tips.[9]

See also[edit]

References[edit]

  1. ^ "Essig Museum of Entomology Collections". Essigdb.berkeley.edu. Retrieved 2012-01-25. 
  2. ^ "Rhagio mystaceus | Atlas of Living Australia". Bie.ala.org.au. Retrieved 2012-01-25. 
  3. ^ "Snipe Fly - Rhagio mystaceus". Cirrusimage.com. Retrieved 2012-01-25. 
  4. ^ "ADW: Rhagio mystaceus: Classification". Animaldiversity.ummz.umich.edu. Retrieved 2012-01-25. 
  5. ^ "Species Rhagio mystaceus - Common Snipe Fly". BugGuide.Net. Retrieved 2012-01-25. 
  6. ^ "ITIS Standard Report Page: Rhagio mystaceus". Itis.gov. Retrieved 2012-01-25. 
  7. ^ "University of Wisconsin-Insect Research Collection - Family Rhagionidae". Entomology.wisc.edu. 2008-07-25. Retrieved 2012-01-25. 
  8. ^ "Rhagio mystaceus, Snipe Fly, Family Rhagionidae". Insectsofwestvirginia.net. Retrieved 2012-01-25. 
  9. ^ "Rhagio mystaceus, Snipe Fly, Family Rhagionidae". Insectsofwestvirginia.net. Retrieved 2012-01-25. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!