Molecular Biology and Genetics

Molecular Biology

Barcode data: Drosophila hydei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCAACAAATCACAAAGATATTGGAACTTTATATTTTATTTTCGGAGCTTGAGCGGGAATAGTGGGAACATCATTAAGTATTCTAATCCGAGCTGAACTGGGTCATCCTGGTGCTTTAATTGGAGAC---GACCAAATTTATAATGTAATCGTCACTGCACATGCTTTTATTATAATTTTTTTTATAGTGATACCTATTATAATCGGTGGGTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTCTTCCCCCTGCTTTATCACTTTTATTAGTAAGAAGTATAGTTGAAAACGGAGCTGGGACAGGGTGAACTGTTTACCCACCTCTATCATCAGGAATCGCCCATGGAGGAGCTTCTGTAAATTTAGCTATTTTTTCTTTACATTTAGCCGGAATCTCTTCAATTTTAGGGGCAGTTAATTTTATTACAACTGTAATTAATATACGATCAACAGGAATTACTCTTGATCGTATACCTTTATTTGTTTGATCAGTCGTAATTACTGCACTTTTATTATTATTATCACTTCCAGTTTTAGCCGGGGCTATTACTATGTTACTAACTGATCGAAATTTAAACACATCATTTTTTGACCCTGCAGGAGGAGGTGACCCAATCCTTTACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCGCATATTATTAGTCAAGAATCAGGAAAAAAGGAAACTTTCGGATCTTTAGGGATAATTTACGCTATGCTTGCAATTGGTTTACTTGGATTTATTGTTTGAGCTCATCATATATTCACTGTAGGAATAGATGTTGATACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Drosophila hydei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Drosophila hydei

Drosophila hydei is a species of Diptera, or the order of flies, in the family Drosophilidae. It is a species in the hydei species subgroup, a group in the repleta species group.[1] Bizarrely, it is also known for having approximately 23mm long sperm, 10 times the length of the male's body.[2]

Hydei are one of the more popular flies used as feeders in the pet trade. A few varieties are available, some flightless.

References[edit]

  1. ^ Greg S. Spicer, Scott Pitnick (1996). "Molecular Systematics of the Drosophila hydei Subgroup as Inferred from Mitochondrial DNA Sequences". J Mol Evol 43 (3): 281–286. doi:10.1007/BF02338836.  PDF
  2. ^ Pitnick, S., and Markow, T.A. (1994). "Large-male advantages associated with costs of sperm production in Drosophila hydei, a species with giant sperm". Proc. Natl. Acad. Sci. USA 91: 9277–9281. doi:10.1073/pnas.91.20.9277. 

Further reading[edit]

  • H. D. Berendes (1965). "Salivary gland function and chromosomal puffing patterns in Drosophila hydei". Chromosoma 17 (1): 35–77. doi:10.1007/BF00285155. 
  • H. D. Berendes and H. G. Keyl (1967). "Distribution of DNA in Heterochromatin and Euchromatin of Polytene Nuclei of Drosophila hydei". Genetics 57 (1): 1–13.  PDF
  • J. B. Boyd, H. D. Berendes and H. Boyd (1968). "Mass Preparation of Nuclei from the Larval Salivary Glands of Drosophila hydei". Journal of Cell Biology 38: 369–376. doi:10.1083/jcb.38.2.369.  PDF
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!