Overview

Brief Summary

Introduction

Drosophila melanogaster is a fly, distributed world wide with the exception of extremes of altitude or latitude.  Its claim to fame is that, for the last 100 years or so, it has been a favourite organism for biological research, initially in the field of genetics, but latter for the investigation of fundamental problems in biology from the fields of ecology to neurobiology.  Systematically, D. melanogaster belongs to the large family of Drosophilae (with over 4,000 known species), a family of acalyptrate flies. By and large members of this family are specialized to feed, as larvae, on rotting vegetable matter that is undergoing fermentation due to yeast or bacterial contamination. It is these microorganisms that constitute the food of larval Drosophila.  In the laboratory, however, D. melanogaster is grown on a flour-based medium gelled with agar and seeded with baker's yeast.

D. melanogaster is a commensal of humans, a history recently reviewd by Keller [18].  It is most commonly found in close association with human habitation, and is often found inside houses, especially in the fall where it is attracted by fruit and wine.  Adults are often found drowned in a glass of wine left in a room overnight. The ecological versatility required to associate with human habitations, from the coasts of New Guinea to Manhattan, has predisposed D. melanogaster to be a very robust laboratory organism. The world-wide distribution of this fly is relatively recent, however. Its ancestral home is thought to be tropical West Africa.  From there it spread to Euroasia, perhaps 6,000-10,000 years ago. It spread to the Americas only 500 or so years ago, probably on trans-Atlantic slave ships.

Although described in the scientific literature in 1830, by the German entomologist Johann Wilhelm Meigen (1764-1845) [1], these flies were known to the Ancient Greeks.  The first experimental studies with D. melanogaster were done, just over a century ago, by F.W. Carpenter and by William Castle [2] in Harvard, for studies of the effects of inbreeding on fecundity. Castle's work showed that D. melanogaster was suitable for experimental work and brought it to the attention of Thomas Hunt Morgan, an embryologist at Columbia University in New York who wished to make an experimental study of evolution  [see 3 for a historical accounts of the introduction of Drosophila into research and of the Morgan School].  His discovery, in 1910, of a white-eyed variant, and his demonstration that this factor showed sex-linked inheritance, was seminal to the then new field of genetics [4]. Over the next thirty years or so, Morgan's school and colleagues established the foundations of classical genetics, a fact recognised by the award of a Nobel Prize to Morgan in 1933 and to his student H.J. Muller in 1946, the latter being for Muller's discovery in 1928 that X-rays can cause mutations.

Today, there are about 7,500 researchers devoted to the study of fundamental problems in biology working with Drosophila. Many advances in our understanding of human development and human disease have come from this work, a fact recognised by the award in 1995 of the Nobel Prize for Physiology or Medicine to three Drosophila workers, Ed Lewis, Eric Weischaus and Christiane Nüsslein-Volhard.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Succinct

Drosophila are small flies, that is to say members of the Order Diptera. Adult D. melanogaster are about 1 mm in length, the female being slightly larger than the male. They are distinguished from most closely related flies by their "pectinate" aristae, hair-like structures carried by their antennae.  When flying D. melanogaster and its relatives and its relatives have a very distinctive "jizz", hard to describe but once seen forever recognized and diagnostic.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Research Data

The research information available for D. melanogaster is huge, over 77,000 research publications (a PUBMED search on "Drosophila" gives over 62,000 returns; but this misses much of the earlier literature.  A reasonably complete bibliography of publications on Drosophilidae is available from FlyBase.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Drosophila macquarti has been introduced to every continent of the world with one exception, Antarctica. On other continents its range is limited only by mountain ranges, deserts, and high lattitudes. (Demerec 1950) The natural range of D. melanogaster is throughout the Old World tropics. Humans have helped to spread Drosophila macquarti to every other location which it inhabits.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced ); oriental (Native ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

  • Patterson, J., W. Stone. 1952. Evolution in the Genus Drosophila. New York: Macmillan Co..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Evolution

D. melanogaster is cosmopolitan in its distribution, only not being found at extremes of altitude and latitude.  It is generally a synanthropic species, being found in close or reasonably close association with humans.

D. melanogaster is a member of the subgenus Sophophora of the genus Drosophila. The Sophophora include several major species-groups, of which the following are the largest: the melanogaster species-group, with a predominantly Oriental and Afrotropic distribution; the obscura species-group, predominantly Holarctic, and the Neotropical willistoni and saltans species-groups. The melanogaster species-group, with 180 or so described species is now considered to be divided into 12 species-subgroups, nearly all of which have an Oriental distribution. The melanogaster species subgroup is an exception, it is an Afrotropical group, with nine known members:

                                                                                   
A historical account of their discovery has recently been published by David et al. [16].

These nine species are sibling species, in the sense of Ernst Mayr, that is to say they are morphologically very similar, indeed the females cannot reliably be distinguished by their external characteristics. The males can, by the morphologies of their external genitalia.

Like D. melanogaster, D. simulans has a cosmopolitan distribution (though perhaps not as widespread as the former species). The other seven species are more restricted. D. yakuba and D. teissieri are widespread in sub-Saharan Africa, the former being a savannah species, the latter a forest species. D. santomea, very closely related to D. yakuba (with which it forms interspecific hybrids in the wild) is a montane species on the island of Sao Tome. D. erecta and D. orena are tropical west African species, the former specialized to the fruits of Pandanus, the latter only having been found once, on Mount Lefo in the Western Cameroon.  D. mauritiana and D. sechellia are insular species on their cognate Indian Ocean islands; the latter is specialized to breed in the foul-smelling fruits of the rubiaceous shrub Morinda citrifolia.

The phylogenetic relationships among these nine species is reasonably well understood, primarily from the analyses of their polytene chromosome banding patterns and from analyses of their DNA sequences.

The age of this small species-subgroup is estimated as about 20 MY, the founders of the subgroup having entered the Afrotropical Region from Eurasia, presumably across a landbridge after the closure of the Tethys Sea.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Drosophila mature through complete metamorphosis, as do all members of the order Diptera.

Similar to all insects Drosophila is covered in a chitinous exoskeleton; has three main body segments; and has three pairs of segmented legs.

Adult: The common fruit fly is normally a yellow brown (tan) color, and is only about 3 mm in length and 2 mm in width (Manning 1999, Patterson, et al 1943). The shape of the common fruit fly's body is what one would normally imagine for a species of the order Diptera. It has a rounded head with large, red, compound eyes; three smaller simple eyes, and short antennae. Its mouth has developed for sopping up liquids (Patterson and Stone 1952). The female is slightly larger than the male (Patterson, et al 1943). There are black stripes on the dorsal surface of its abdomen, which can be used to determine the sex of an individual. Males have a greater amount of black pigmentation concentrated at the posterior end of the abdomen (Patterson and Stone 1952).

Like other flies, Drosophila macquarti has a single pair of wings that form from the middle segment of its thorax. Out of the last segment of its throax (which in other insects contains a second pair of wings) develops a set rudimentry wings that act as knobby balancing organs. These balancing organs are called halteres. (Raven and Johnson 1999)

Larvae are minute white maggots lacking legs and a defined head.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Drosophila macquarti lives in a wide range of habitats. Native habitats include those in the tropical regions of the Old World, but the common fruit fly has been introduced to almost all temperate regions of the world. The only aspects that limit the habitats Drosopila melangaster can live in is temperature and availability of water.  The scientific name Drosophila actually means "lover of dew", implying that this species requires moist environments.

The development of this species' offspring is extremely dependent on temperature, and the adults cannot withstand the colder temperatures of high elevations or high latitudes. Food supplies are also limited in these locations. Therefore, in colder climates Drosophila macquarti cannot survive.

In temperate regions where human activities have introduced Drosophila macquarti, these flies seek shelter in colder winter months. Many times Drosophila can be found in fruit cellars, or other available man made structures with a large supply of food.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Drosophila melanogaster is typically a commensal of humans and is frequently found wherever there are suitable breeding substrates, in particular rotting fruit.  Populations tend to peak in the fall, when fruit crops typically ripen.  For example in the Palaearctic large populations of D. melanogaster are found in orchards and vineyards, and on some soft fruits such as tomatoes. In temperate regions this species probably overwinters as fertilized adult females in a reproductive diapause, inhabiting protected micro-environments.  Where conditions are simply too cold for this to occur populations probably die off every winter, to be repopulated by migration every spring or early summer.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

As the name implies, the fruit flies lives primarily on plant material. The adults thrive on rotting plants, and fruits; while eggs are usually laid on unripened/slightly ripened fruit, so by the time the larva develop the fruit will have just started to rot, and they can use the fruit that the egg was laid on as their primary source of nutrition. Drosophila are considered major pests in some area of the world for this reason.

Plant Foods: fruit

Primary Diet: herbivore (Frugivore )

  • Wilson, .. October,1999. "Fruit Fly(Drosophila)" (On-line). Accessed February 16, 2000 at http://agri.gov.ns.ca/pt/hort/organic/ptor9705.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Associations

Animal / parasitoid / endoparasitoid
larva of Ganaspis subnuda is endoparasitoid of larva of Drosophila melanogaster

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecosystem Role

One major role of D. melanogaster in the ecosystem is that is an efficient vector for microorganisms, bacteria and fungi.  Its role in the transmission of yeasts such as Saccharomyces cererisiae has been recognised for well over a century [11] and many hundreds of different fungal species have been isolated from the guts of wild drosophilids, many of these species in fact first being described from such a source.  Drosophilids have been implicated as vectors of plant pathogenic fungi and of plant pathogenic bacteria. They are importance to viniculture, as vectors of yeasts.

Although a "typical" drosophilid has saprophagous larvae feeding on a fermenting substrate this is not true of all members of the family.  In particular members of the more "primitive" Steganine subfamily do not utilize fermenting substrates, and many of the more "advanced" Drosophiline subfamily have transferred to non-fermenting substrates, such as fleshy fungi and living flowers.  Some species have adapted to more bizarre habitats, for example breeding in the gills of land crabs, as aquatic predators, as kleptoparasites of solitary bees, or as predators of mealy bug or white fly larvae (see [12]).

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecological Determinants/Niche

The major ecological determinants are temperature and humidity, and the availability of suitable breeding substrates. For this reason this fly is absent from extremes of latitude and altitude and from deserts. It is otherwise very catholic in its distribution.
Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
0.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 0.3 years Observations: The fruit fly is mostly composed of post-mitotic cells, has a very short lifespan, and shows gradual ageing. Like in other species, temperature influences the life history of the animal. Several genes have been identified whose manipulation extends the lifespan of these animals (Helfand and Rogina 2003).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Reproduction in Drosophila is rapid. A single pair of flies can produce hundreds of offspring within a couple of weeks, and the offspring become sexually mature within one week (Lutz 1948).

As in all insect species Drosophila macquarti lays eggs. The eggs are placed on fruit, and hatch into fly larvae (maggots), which instantly start consuming the fruit on which they were laid (Patterson and Stone 1952).

Male flies have sex combs on their front legs. It has been theorized that these sex combs might be used for mating. However, when these combs are removed it seems to have little effect on mating sucess (Patterson, et al 1943).

Average age at sexual or reproductive maturity (female): 1 weeks.

Average age at sexual or reproductive maturity (male): 1 weeks.

Key Reproductive Features: semelparous ; year-round breeding ; sexual ; fertilization (Internal ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
7 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
7 days.

  • Patterson, J., W. Stone. 1952. Evolution in the Genus Drosophila. New York: Macmillan Co..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction and Life History

Under laboratory conditions, typically a temperature of 25C and a relatively high humidity, D. melanogaster has a life cycle of 10 days.  There are three larval instars, and this is the period of development in which all growth occurs.

This times spent in the three major stages are:

  • Embryonic development: 24h.
  • Larval development: 96h.
  • Pupal development: 96-120h.

Adult flies typically emerge according to a circadian rhythm and females are unreceptive to the attention of males for about the first 8-10 hours of their lives.  This is of great practical importance, because it means that flies separated by their sex during this period will be virgin and can be used in controlled crosses.

Under "typical" laboratory conditions the life span of D. melanogaster is 45-60 days.  There have been very extensive studies of the environmental and genetic influences on life span and this species is extensively used for studies of aging, see reference [17] for a recent review of the literature.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Fossil History

Paleontology

No fossils of D. melanogaster are known.  There are a handful of Eocene amber fossils of steganine drosophilids described from Europe, and several Miocene and Oligocene amber species described from New World amber [13].
Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Systematics or Phylogenetics

Synonyms

Drosophila ampelophaga de Meijere, 1939
Drosophila ampelophila Loew, 1862
Drosophila approximata Zetterstedt, 1847
Drosophila artificialis Kozhevnikov, 1936
Drosophila emulata Ray-Chaudhuri and Mukherjee, 1941
Drosophila fasciata Meigen, 1830
Drosophila immatura Walker 1849
Drosophila melanocephala de Meijere, 1946
Drosophila nigriventris MacQuart, 1842
Drosophila pilosula Becker, 1908
Drosophila uvarum Rondani, 1875

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional Adaptations

Functional adaptation

Sensory bristles organize with minimum communication: fruit flies
 

The sensory organ precursors (starting point of sensory bristles) of fruit flies organize themselves with minimal knowledge and communication.

       
  "Computational and mathematical methods are extensively used to analyze and model biological systems…We provide an example of the reverse of this strategy, in which a biological process is used to derive a solution to a long-standing computational problem…All large-scale computing efforts, from web search to airplane control systems, use distributed computing algorithms to reach agreement, overcome failures, and decrease response times. Biological processes are also distributed. Parallel pathways are used to transform environmental signals to gene expression programs, and several tasks are jointly performed by independent cells without clear control."

[A long-standing distributed computing problem is that of electing a local set of leaders, called the maximal independent set or MIS, in a network of connected processors.]

"The selection of neural precursor during the development of the [fruit fly] nervous system resembles the MIS election problem. The precursors of the fly's sensory bristles [sensory organ precursors (SOPs)] are selected during larvae and pupae development from clusters of equivalent cells…a cell that is selected as a SOP inhibits its neighbors by expressing high level of the membrane-bound protein Delta, which binds and activates the transmembrane receptor protein Notch on adjacent cells…This lateral-inhibition process is highly accurate…resulting in a regularly spaced pattern in which each cell is either selected as SOP or is inhibited by a neighboring SOP…Thus, as in the MIS problem every proneural cluster must elect a set of SOPs (A) so that every cell in the cluster is either in A or connected to a SOP in A, and no two SOPs in A are adjacent."

"Although similar, the biological solution differs from computational algorithms in at least two aspects. First, SOP selection is probably performed without relying on knowledge of the number of neighbors that are not yet selected. Second, mathematical analysis demonstrated that SOP selection requires nonlinear inhibition that in effect reduces communication to the simplest set of possible messages (binary)." (Yehuda et al. 2011:182-183)

  Learn more about this functional adaptation.
  • Yehuda A; Alon N; Barad O; Hornstein E; Barkai N; Bar-Joseph Z. 2011. A biological solution to a fundamental distributed computing problem. Science. 331(6014): 183-185.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Immune system is fortified: animals
 

The immune system in animals is fortified as a precaution in times of energy shortage by a hunger- or stress-induced mechanism that releases antimicrobial peptides.

   
  "Bonn researchers have discovered an elementary mechanism which regulates  vital immune functions in healthy people. In situations of hunger which  mean stress for the body's cells, the body releases more antimicrobial  peptides in order to protect itself.

"…The biomedical researchers from the LIMES Institute at the University  of Bonn have been able to show in fruit flies but also in human tissue  that this natural immune defence system is linked directly to the  metabolic status via the insulin signalling pathway. 

"If we have not eaten for a while or have to climb many stairs, the  energy level of our cells drops and with it the level of insulin. The  researchers from Bonn have now discovered that in the case of a low  insulin level the FOXO transcription factor is activated. A  transcription factor can switch genes on and off. FOXO switches genes  for immune defence proteins on when energy is needed. These  antimicrobial peptides (AMP) -- not to be confused with antibodies --  are subsequently jettisoned by the body's cells. They destroy possible  pathogens by dissolving their cell walls.

 

"…In situations of hunger which mean stress for the body cells, the body  releases antimicrobial peptides as a precaution in order to protect  itself." (Science Daily 2010)

 

  Learn more about this functional adaptation.
  • Becker T; Loch G; Beyer M; Zinke I; Aschenbrenner AC; Carrera P; Inhester T; Schultze JL; Hoch M. 2010. FOXO-dependent regulation of innate immune homeostasis. Nature. 463(7279): 369-373.
  • 2010. Hungry immune guardians are snappier: nutrition has a direct influence on the immune system. Science Daily [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Flight path maintained: fruit fly
 

Fruit flies recover their flight path after wind gusts and other disturbances with an automatic stabilizer reflex.

         
  "Observing the aerial maneuvers of fruit flies, Cornell University  researchers have uncovered how the insects -- when disturbed by sharp  gusts of wind -- right themselves and stay on course. Fruit flies use an  automatic stabilizer reflex that helps them recover with precision from  midflight stumbles" (Science Daily 2010)

Watch video
  Learn more about this functional adaptation.
  • Ristroph L; Bergou AJ; Ristroph G; Coumes K; Berman GJ; Guckenheimer J; Wang ZJ; Cohen I. 2010. Discovering the flight autostabilizer of fruit flies by inducing aerial stumbles. PNAS. 107(11): 4820-4824.
  • 2010. Staying the course: fruit flies employ stabilizer reflex to recover from midflight stumbles. Science Daily [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Antenna provides selective hearing: fruit fly
 

The antenna of a fruit fly is used for selective hearing thanks to its multi-part, swiveling structure.

   
  "The fly Drosophila melanogaster has very small hearing organs each of which consists of 3 antennal segments and a feather-like arista. These parts constitute together the sound receiver. When a desired sound is heard, the arista rotates one of the antennas and penetrates a hook into the second antenna (the internal one) and stretches the auditory receptors. At such conditions the auditory receptors can function and enable hearing. Otherwise the Drosophila melanogaster hearing is prevented." (Collins 2004:170)
  Learn more about this functional adaptation.
  • Collins, M. 2004. Design and nature II: comparing design in nature with science and engineering. Southampton: WIT.
  • Göpfert, MC; Robert, D. 2001. Turning the key on Drosophila audition. Nature. 411(6840): 908.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Taste neurons detect CO2: fruit fly
 

The sensory system of fruit flies detects CO2 via specialized taste neurons.

   
  "Here we identify a novel taste modality in this insect: the taste of carbonated water. We use a combination of anatomical, calcium imaging and behavioural approaches to identify a population of taste neurons that detects CO2." (Fischler 2007:1054)
  Learn more about this functional adaptation.
  • Fischler, Walter; Kong, Priscilla; Marella, Sunanda; Scott, Kristin. 2007. The detection of carbonation by the Drosophila gustatory system. Nature. 448(7157): 1054-1057.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Fly has fast wingbeat: fruit fly
 

The indirect flight muscles of the fruit fly allow high wingbeat frequencies via a fast actomyosin reaction.

   
  "The evolution of flight in small insects was accompanied by striking adaptations of the thoracic musculature that enabled very high wing beat frequencies. At the cellular and protein filament level, a stretch activation mechanism evolved that allowed high-oscillatory work to be achieved at very high frequencies as contraction and nerve stimulus became asynchronous. At the molecular level, critical adaptations occurred within the motor protein myosin II, because its elementary interactions with actin set the speed of sarcomere contraction…In conclusion, we have shown that in the fastest known muscle type, insect asynchronous IFM, constraints on strong binding steps of the cross-bridge cycle are unleashed by moving the rate-limiting step of the cycle to be closely associated with phosphate release. The constraints on strong binding are also relaxed by equipping the muscle with a high density of mitochondria that not only supplies the large quantities of MgATP fuel required for energetically costly flight (2, 25) but likely also to maintain an unusually high [MgATP]." (Swank et al. 2007:17543, 17545)
  Learn more about this functional adaptation.
  • Swank, Douglas M.; Vishnudas, Vivek K.; Maughan, David W. 2006. An exceptionally fast actomyosin reaction powers insect flight muscle. Proceedings of the National Academy of Sciences. 103(46): 17543-17547.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Cell Biology

Chromosomal Data

The mitotic metaphase chromosomes of Drosophila were first studied in 1907 by Stevens [9]. The haploid chromosome number of D. melanogaster  is 8, there being an acrocentric X chromosome, two metacentric autosomes (chromosomes 2 and 3) and a dot like 4th chromosome. In the male there is a J-shaped Y chromosome. In the family Drosophilidae as a whole the primitive chromosome number would appear to be n=6, with five long acrocentric chromosomes and a small dot like chromosome.  Reduction in chromosome number has occurred many independent times by fusions of these elements.

Drosophila, like many other Diptera, possess polytene chromosomes in their larval tissues and ovarian nurse cells. Polytene nuclei are polyploid, they result from successive rounds of DNA replication without nuclear division. What distinguishes these polyploid nuclei is that the individual chromosome remain very tightly apposed to form very large polytene chromosomes, about 3 microns in diameter and hundreds of microns in length in their best developed form, in the salivary glands of third instar larvae.

Polytene chromosomes have a striking aperiodic pattern of strongly condensed bands and lightly condensed interbands. This pattern is constant within the species and detailed maps of these chromosomes were drawn in the 1930's and early 1940's, recognizing about 5000 bands.  These have been very extensively used by geneticists to map chromosome mutations, to study gene function, since active genes may often be distinguished by a transient "puffing" of a band, and for evolutionary and population studies.

The reasons for their use in evolutionary and population studies are (a) that natural populations of D. melanogaster, and other species, are polymorphic for chromosome inversions; and (b) that closely related species of Drosophila often differ by fixed chromosome inversions.  As Sturtevant realized in the mid-1930's these could be used for phylogenetic analyses.  The best example of this is Hampton Carson's phylogeny over over 120 species of Hawaiian picture-winged species of drosophild based on their patterns of shared and unique chromosome inversions [10].

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Drosophila melanogaster

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 220 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBDP2871-06|M57910|Drosophila melanogaster| CGACAATGATTATTTTCTACAAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAGCTTGAGCTGGAATAGTTGGAACATCTTTA---AGAATTTTAATTCGAGCTGAATTAGGACATCCTGGAGCATTAATTGGAGAT---GATCAAATTTATAATGTAATTGTAACTGCACATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTGCCTTTAATA---TTAGGTGCTCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTACTACCTCCTGCTCTTTCTTTACTATTAGTAAGTAGAATAGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCACCTTTATCCGCTGGAATTGCTCATGGTGGAGCTTCAGTTGATTTA---GCTATTTTTTCTCTACATTTAGCAGGGATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCAACAGGAATTTCATTAGATCGTATACCTTTATTTGTTTGATCAGTAGTTATTACTGCTTTATTATTATTATTATCACTTCCAGTACTAGCAGGA---GCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCAGCGGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTAGACAAGAATCAGGAAAAAAG---GAAACTTTTGGTTCTCTAGGAATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACCGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Drosophila melanogaster

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 220
Species: 307
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genome size. The most recent estimate of the size of the genome of D. melanogaster is just under 200-Mb [5].  Of these 200-Mb, about one-third is heterochromatic, contained on the Y-chromosome (of the male) and the chromosomal regions that surround the centromeres. About half of these heterochromatic sequences are satellite sequences, of very simple sequence, and about half are complex sequences largely, but not entirely, composed of transposable elements.

Sequences. D. melanogaster is one of the few multicellular organisms to have its genome "completely" sequenced.  This was first published in 2000 [6] as the result of a novel collaboration between a commercial company and the academic sector (see [7]). Since then efforts by researchers in Berkeley have improved and revised this sequence, and the current version (R5) is available from GenBank with the following accession numbers: AE014134, AE013599, AE014296, AE014297, AE014135 and AE014298. The complete mitochondrial genome sequence is available as GenBank:U37541. {note 1}.

There are over 765,000 other sequence records for D. melanogaster available from GenBank as well as over 31,000 protein sequences available from the protein sequence databank UniProt.

Despite this wealth of data the genome of D. melanogaster is not yet complete.  The sequencing of the complex portion of the heterochromatin is still in progress in Berkeley <http://www.dhgp.org/>, and the simple sequence satellite DNA will probably never be fully sequenced.

In addition to D. melanogaster, genomic sequences have been achieved for 11 other members of the family Drosophilidae, including D. simulans, D. yakuba and D. erecta, closely related sibling species of D. melanogaster [8].

What distinguishes the genomic sequence of D. melanogaster from that of many other species is the depth and detail of its annotation.  Within the sequenced chromosome arms there are now only seven sequence gaps (all numbers will be from Release 5.5 of January 2008) and 15,186 genes are located to genome.  The great majority of these (14,146) encode proteins, the remainder non-coding RNA species (e.g., transfer RNAs, ribosomal RNAs, small nucleolar RNAs, microRNAs). The annotation of this genome is the responsibility of FlyBase, the community database for Drosophila genetics and genomics.

About 9,000 of the 15,000 or so genes of D. melanogaster have been identified by experimentally induced mutant alleles. In recent years these mutations have been induced using genetically engineered transposable elements and large-scale screens to disrupt every gene in this species are underway <http://flypush.imgen.bcm.tmc.edu/pscreen/>.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation

There are no conservation issues with respect to D. melanogaster.  Its synanthropic habitat makes it a robust species and its tolerance to a wide range of temperature (in the laboratory it can breed over the range 13-30C) makes it unlikely that it will be much affected by climate change.

Some species of drosophilid, particularly some of the Hawaiian species are, however, critically endangered, due to habit destruction, the use of insecticides by the sugar cane industry and the introduction of predators, such as the yellow jacket.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Eradication

Populations of D. melanogaster have, on occasion, reached pest status, for example in tomato fields and fig orchards. The infestation of Drosophila in homes sometimes becomes a nuisance.  One related species, D. repleta, has quite often had nuisance value in restaurants and public houses. Infestations in both domestic and commercial premises are best handled by ensuring that potential breeding sites (typically rotting fruit) are cleaned up.
Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Drosophila macquarti has been known to over winter in storage facilites, where it can consume/ruin vast quatities of food. As stated above, the fruit fly also lays its eggs on unripened fruit, and is considered a pest in many areas. (Demeric 1950, Wilson 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This species is widely used in scientific research.

Positive Impacts: source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relation to Humans

No species of drosophilid has any implication for human health.  There are one or two possible cases of myiasis reported in the literature, and some laboratory workers may develop an allergy, either to the flies themselves, or, more likely to other materials in the laboratory environment (yeasts, cotton wool).

The laboratory culture of D. melanogaster is robust and very well understood and detailed accounts are available in the literature [14, 15].

Over 30,000 different mutant strains of D. melanogaster are maintained in public stock collections in the US, Europe, Japan and India (see <http://flybase.org/static_pages/allied-data/external_resources5.html>).

The most important use of D. melanogaster is as a model organism for biomedical research.  Here, its importance cannot be overstated.  There is an estimated 7,500 researchers world-wide working with this species and publishing about 3,000 primary research papers a year.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Drosophila melanogaster

Drosophila melanogaster (Greek for dark-bellied dew lover : δρόσος = dew, φίλος = lover, μέλας = dark-coloured, γαστήρ = belly[2]) is a species of Diptera, or the order of flies, in the family Drosophilidae. The species is known generally as the common fruit fly or vinegar fly. Starting from Charles W. Woodworth, this species is a model organism that is widely used for biological research in studies of genetics, physiology, microbial pathogenesis and life history evolution. It is typically used because it is an animal species that is easy to care for, breeds quickly, and lays many eggs.[3]

Flies belonging to the family Tephritidae are also called fruit flies, which can lead to confusion, especially in Australia and South Africa, where the term fruit fly refers to members of the Tephritidae that are economic pests in fruit production, such as Ceratitis capitata, the Mediterranean fruit fly or "Medfly".

Contents

Physical appearance

Male (left) and female D. melanogaster

Wildtype fruit flies have brick red eyes, are yellow-brown in color, and have transverse black rings across their abdomen. They exhibit sexual dimorphism: females are about 2.5 millimeters (0.098 in) long; males are slightly smaller and the back of their bodies is darker. Males are easily distinguished from females based on color differences, with a distinct black patch at the abdomen, less noticeable in recently emerged flies (see fig), and the sexcombs (a row of dark bristles on the tarsus of the first leg). Furthermore, males have a cluster of spiky hairs (claspers) surrounding the reproducing parts used to attach to the female during mating. There are extensive images at FlyBase.[4]

Life cycle and reproduction

The D. melanogaster lifespan is about 30 days at 29 °C (84 °F).

The developmental period for Drosophila melanogaster varies with temperature, as with many ectothermic species. The shortest development time (egg to adult), 7 days, is achieved at 28 °C (82 °F).[5][6] Development times increase at higher temperatures (11 days at 30 °C or 86 °F) due to heat stress. Under ideal conditions, the development time at 25 °C (77 °F) is 8.5 days,[5][6][7] at 18 °C (64 °F) it takes 19 days[5][6] and at 12 °C (54 °F) it takes over 50 days.[5][6] Under crowded conditions, development time increases,[8] while the emerging flies are smaller.[8][9] Females lay some 400 eggs (embryos), about five at a time, into rotting fruit or other suitable material such as decaying mushrooms and sap fluxes. The eggs, which are about 0.5 millimetres long, hatch after 12–15 hours (at 25 °C or 77 °F).[5][6] The resulting larvae grow for about 4 days (at 25 °C) while molting twice (into 2nd- and 3rd-instar larvae), at about 24 and 48 h after hatching.[5][6] During this time, they feed on the microorganisms that decompose the fruit, as well as on the sugar of the fruit itself. Then the larvae encapsulate in the puparium and undergo a four-day-long metamorphosis (at 25 °C), after which the adults eclose (emerge).[5][6]

Mating fruit flies. Note the sex combs on the forelegs of the male (insert)

Females become receptive to courting males at about 8–12 hours after emergence.[10] Males perform a sequence of five behavioral patterns to court females. First, males orient themselves while playing a courtship song by horizontally extending and vibrating their wings. Soon after, the male positions itself at the rear of the female's abdomen in a low posture to tap and lick the female genitalia. Finally, the male curls its abdomen, and attempts copulation. Females can reject males by moving away, kicking and extruding their ovipositor. Copulation lasts around 15–20 minutes,[11] during which males transfer a few hundred very long (1.76 mm) sperm cells in seminal fluid to the female.[12] Females store the sperm in a tubular receptacle and in two mushroom-shaped spermathecae, sperm from multiple matings compete for fertilization. A last male precedence is believed to exist in which the last male to mate with a female sires approximately 80% of her offspring. This precedence was found to occur through displacement and incapacitation.[13] The displacement is attributed to sperm handling by the female fly as multiple matings are conducted and is most significant during the first 1–2 days after copulation. Displacement from the seminal receptacle is more significant than displacement from the spermathecae.[13] Incapacitation of first male sperm by second male sperm becomes significant 2–7 days after copulation. The seminal fluid of the second male is believed to be responsible for this incapacitation mechanism (without removal of first male sperm) which takes effect before fertilization occurs.[13] The delay in effectiveness of the incapacitation mechanism is believed to be a protective mechanism that prevents a male fly from incapacitating its own sperm should it mate with the same female fly repetitively.[13]

History of use in genetic analysis

Lab cultures

Drosophila melanogaster was among the first organisms used for genetic analysis, and today it is one of the most widely used and genetically best-known of all eukaryotic organisms. All organisms use common genetic systems; therefore, comprehending processes such as transcription and replication in fruit flies helps in understanding these processes in other eukaryotes, including humans.[14]

Charles W. Woodworth is credited with being the first to breed Drosophila in quantity and for suggesting to W. E. Castle that they might be used for genetic research during his time at Harvard University.

Thomas Hunt Morgan began using fruit flies in experimental studies of heredity at Columbia University in 1910. His laboratory was located on the top floor of Schermerhorn Hall, which became known as the Fly Room. The Fly Room was cramped with eight desks, each occupied by students and their experiments. They started off experiments using milk bottles to rear the fruit flies and handheld lenses for observing their traits. The lenses were later replaced by microscopes, which enhanced their observations. The Fly Room was the source of some of the most important research in the history of biology. Morgan and his students eventually elucidated many basic principles of heredity, including sex-linked inheritance, epistasis, multiple alleles, and gene mapping.[14]

"Thomas Hunt Morgan and colleagues extended Mendel's work by describing X-linked inheritance and by showing that genes located on the same chromosome do not show independent assortment. Studies of X-linked traits helped confirm that genes are found on chromosomes, while studies of linked traits led to the first maps showing the locations of genetic loci on chromosomes" (Freman 214). The first maps of Drosophila chromosomes were completed by Alfred Sturtevant.

Model organism in genetics

D. melanogaster types (clockwise): brown eyes with black body, cinnabar eyes, sepia eyes with ebony body, vermilion eyes, white eyes, and wild-type eyes with yellow body

Drosophila melanogaster is one of the most studied organisms in biological research, particularly in genetics and developmental biology. There are several reasons:

  • Its care and culture requires little equipment and uses little space even when using large cultures, and the overall cost is low.
  • It is small and easy to grow in the laboratory and their morphology is easy to identify once they are anesthetized (usually with ether, carbon dioxide gas, by cooling them, or with products like FlyNap)
  • It has a short generation time (about 10 days at room temperature) so several generations can be studied within a few weeks.
  • It has a high fecundity (females lay up to 100 eggs per day, and perhaps 2000 in a lifetime).[3]
  • Males and females are readily distinguished and virgin females are easily isolated, facilitating genetic crossing.
  • The mature larvae show giant chromosomes in the salivary glands called polytene chromosomes—"puffs" indicate regions of transcription and hence gene activity.
  • It has only four pairs of chromosomes: three autosomes, and one sex chromosome.
  • Males do not show meiotic recombination, facilitating genetic studies.
  • Recessive lethal "balancer chromosomes" carrying visible genetic markers can be used to keep stocks of lethal alleles in a heterozygous state without recombination due to multiple inversions in the balancer.
  • Genetic transformation techniques have been available since 1987.
  • Its complete genome was sequenced and first published in 2000.[15]

Genetic markers

Genetic markers are commonly used in Drosophila research, for example within balancer chromosomes or P-element inserts, and most phenotypes are easily identifiable either with the naked eye or under a microscope. In the list of example common markers below, the allele symbol is followed by the name of the gene affected and a description of its phenotype. (Note: Recessive alleles are in lower case, while dominant alleles are capitalised.)

  • Cy1: Curly; The wings curve away from the body, flight may be somewhat impaired.
  • e1: ebony; Black body and wings (heterozygotes are also visibly darker than wild type).
  • Sb1: stubble; Bristles are shorter and thicker than wild type.
  • w1: white; Eyes lack pigmentation and appear white.
  • y1: yellow; Body pigmentation and wings appear yellow. This is the fly analog of albinism.

Drosophila genes are traditionally named after the phenotype they cause when mutated. For example, the absence of a particular gene in Drosophila will result in a mutant embryo that does not develop a heart. Scientists have thus called this gene tinman, named after the Oz character of the same name.[16] This system of nomenclature results in a wider range of gene names than in other organisms.

Genome

D. melanogaster chromosomes to scale with megabase-pair references oriented as in the National Center for Biotechnology Information database. Centimorgan distances are approximate and estimated from the locations of selected mapped loci.

The genome of D. melanogaster (sequenced in 2000, and curated at the FlyBase database[15]) contains four pairs of chromosomes: an X/Y pair, and three autosomes labeled 2, 3, and 4. The fourth chromosome is so tiny that it is often ignored, aside from its important eyeless gene. The D. melanogaster sequenced genome of 139.5 million base pairs has been annotated[17] and contains approximately 15,016 genes. More than 60% of the genome appears to be functional non-protein-coding DNA[18] involved in gene expression control. Determination of sex in Drosophila occurs by the ratio of X chromosomes to autosomes, not because of the presence of a Y chromosome as in human sex determination. Although the Y chromosome is entirely heterochromatic, it contains at least 16 genes, many of which are thought to have male-related functions.[19]

Similarity to humans

About 75% of known human disease genes have a recognizable match in the genome of fruit flies,[20] and 50% of fly protein sequences have mammalian homologs. An online database called Homophila is available to search for human disease gene homologues in flies and vice versa.[21] Drosophila is being used as a genetic model for several human diseases including the neurodegenerative disorders Parkinson's, Huntington's, spinocerebellar ataxia and Alzheimer's disease. The fly is also being used to study mechanisms underlying aging and oxidative stress, immunity, diabetes, and cancer, as well as drug abuse.

Development

Embryogenesis in Drosophila has been extensively studied, as its small size, short generation time, and large brood size makes it ideal for genetic studies. It is also unique among model organisms in that cleavage occurs in a syncytium.

During oogenesis, cytoplasmic bridges called "ring canals" connect the forming oocyte to nurse cells. Nutrients and developmental control molecules move from the nurse cells into the oocyte. In the figure to the left, the forming oocyte can be seen to be covered by follicular support cells.

After fertilization of the oocyte the early embryo (or syncytial embryo) undergoes rapid DNA replication and 13 nuclear divisions until approximately 5000 to 6000 nuclei accumulate in the unseparated cytoplasm of the embryo. By the end of the 8th division most nuclei have migrated to the surface, surrounding the yolk sac (leaving behind only a few nuclei, which will become the yolk nuclei). After the 10th division the pole cells form at the posterior end of the embryo, segregating the germ line from the syncytium. Finally, after the 13th division cell membranes slowly invaginate, dividing the syncytium into individual somatic cells. Once this process is completed gastrulation starts.[22]

Nuclear division in the early Drosophila embryo happens so quickly there are no proper checkpoints so mistakes may be made in division of the DNA. To get around this problem, the nuclei that have made a mistake detach from their centrosomes and fall into the centre of the embryo (yolk sac), which will not form part of the fly.

The gene network (transcriptional and protein interactions) governing the early development of the fruit fly embryo is one of the best understood gene networks to date, especially the patterning along the antero-posterior (AP) and dorso-ventral (DV) axes (See under morphogenesis).[22]

The embryo undergoes well-characterized morphogenetic movements during gastrulation and early development, including germ-band extension, formation of several furrows, ventral invagination of the mesoderm, posterior and anterior invagination of endoderm (gut), as well as extensive body segmentation until finally hatching from the surrounding cuticle into a 1st-instar larva.

During larval development, tissues known as imaginal discs grow inside the larva. Imaginal discs develop to form most structures of the adult body, such as the head, legs, wings, thorax and genitalia. Cells of the imaginal disks are set aside during embryogenesis and continue to grow and divide during the larval stages—unlike most other cells of the larva, which have differentiated to perform specialized functions and grow without further cell division. At metamorphosis, the larva forms a pupa, inside which the larval tissues are reabsorbed and the imaginal tissues undergo extensive morphogenetic movements to form adult structures.

Sex Determination

Drosophila have both X and Y chromosomes as well as autosomes. Unlike humans, the Y chromosome does not confer maleness, rather it encodes genes necessary for making sperm. Sex is instead determined by the ratio of autosomes to X chromosomes. Further, each cell "decides" whether to be male or female independently of the rest of the organism resulting in the occasional occurrence of gynandromorphs.

X ChromosomesAutosomesRatio of X:ASex
XXXXAAAA1Normal Female
XXXAAA1Normal Female
XXAA1Normal Female
XAA0.50Normal Male
XXXAA1.50Metafemale
XXXXAAA1.33Metafemale
XXAAA0.66Intersex
XAAA0.33Metamale

3 major genes are involved in determination of Drosophila sex. These are Sex-lethal, Sisterless and Deadpan. Deadpan is an autosomal gene which inhibits sex-lethal while sisterless is carried on the X chromosome and inhibits the action of deadpan. An AAX cell has twice as much deadpan as sisterless and so sex-lethal will be inhibited creating a male. On the other hand an AAXX cell will produce enough sisterless to inhibit the action of deadpan allowing the sex-lethal gene to be transcribed creating a female.

Later control by deadpan and sisterless disappears and what becomes important is the form of the sex-lethal gene. A secondary promoter causes transcription in both males and females. Analysis of the cDNA has shown that different forms are expressed in males and females. Sex-lethal has been shown to affect the splicing of its own mRNA. In males the 3rd exon is included which encodes a stop codon causing a truncated form to be produced. In the female version, the presence of sex-lethal causes this exon to be missed out the other 7 amino acids are produced as a full peptide chain, again giving us a difference between males and females. [23]

Presence or absence of functional Sex-lethal proteins now go on to affect the transcription of another protein known as Doublesex. In the absence of sex-lethal, Doublesex will have the 4th exon removed and be translated up to and including exon 6 (DSX-M[ale]), while in its presence the 4 exon which encodes a stop codon will produce a truncated version of the protein (DSX-F[emale]). DSX-F causes transcription of Yolk proteins 1 and 2 in somatic cells which will be pumped into the oocyte on its production.

Immunity

Unlike mammals, Drosophila only have innate immunity and lack an adaptive immune response. The D. melanogaster immune system can be divided into two responses: humoral and cell-mediated. The former is a systemic response mediated through the Toll and imd pathways, which are parallel systems for detecting microbes. The Toll pathway in Drosophila is known as the homologue of Toll-Like pathways in mammals. Spatzle, a known ligand for the Toll pathway in flies, is produced in response to Gram-positive bacteria, parasites, and fungal infection. Upon infection, pro-Spatzle will be cleaved by protease SPE (Spatzle processing enzyme) to become active Spatzle, which then binds to the Toll receptor located on the cell surface (Fat body, hemocytes) and dimerise for activation of downstream NF-κB signaling pathways. On the other hand, the imd pathway is triggered by Gram-negative bacteria through soluble and surface receptors (PGRP-LE and LC, respectively). D. melanogaster have a "fat body", which is thought to be homologous to the human liver. It is the primary secretory organ and produces antimicrobial peptides. These peptides are secreted into the hemolymph and bind infectious bacteria, killing them by forming pores in their cell walls. Years ago many drug companies wanted to purify these peptides and use them as antibiotics. Other than the fat body, hemocytes, the blood cells in drosophila, are known as the homologue of mammalian monocyte/macrophages, possessing a significant role in immune responses. It is known from the literature that in response to immune challenge, hemocytes are able to secrete cytokines, for example Spatzle, to activate downstream signaling pathways in the fat body. However, the mechanism still remains unclear.

Behavioral genetics and neuroscience

In 1971, Ron Konopka and Seymour Benzer published "Clock mutants of Drosophila melanogaster", a paper describing the first mutations that affected an animal's behavior. Wild-type flies show an activity rhythm with a frequency of about a day (24 hours). They found mutants with faster and slower rhythms as well as broken rhythms—flies that move and rest in random spurts. Work over the following 30 years has shown that these mutations (and others like them) affect a group of genes and their products that comprise a biochemical or biological clock. This clock is found in a wide range of fly cells, but the clock-bearing cells that control activity are several dozen neurons in the fly's central brain.

Since then, Benzer and others have used behavioral screens to isolate genes involved in vision, olfaction, audition, learning/memory, courtship, pain and other processes, such as longevity.

The first learning and memory mutants (dunce, rutabaga etc.) were isolated by William "Chip" Quinn while in Benzer's lab, and were eventually shown to encode components of an intracellular signaling pathway involving cyclic AMP, protein kinase A and a transcription factor known as CREB. These molecules were shown to be also involved in synaptic plasticity in Aplysia and mammals.

Male flies sing to the females during courtship using their wing to generate sound, and some of the genetics of sexual behavior have been characterized. In particular, the fruitless gene has several different splice forms, and male flies expressing female splice forms have female-like behavior and vice-versa.

Furthermore, Drosophila has been used in neuropharmacological research, including studies of cocaine and alcohol consumption.

Vision

Stereo images of the fly eye

The compound eye of the fruit fly contains 760 unit eyes or ommatidia, and are one of the most advanced among insects. Each ommatidium contains 8 photoreceptor cells (R1-8), support cells, pigment cells, and a cornea. Wild-type flies have reddish pigment cells, which serve to absorb excess blue light so the fly isn't blinded by ambient light.

Each photoreceptor cell consists of two main sections, the cell body and the rhabdomere. The cell body contains the nucleus while the 100-μm-long rhabdomere is made up of toothbrush-like stacks of membrane called microvilli. Each microvillus is 1–2 μm in length and ~60 nm in diameter.[24] The membrane of the rhabdomere is packed with about 100 million rhodopsin molecules, the visual protein that absorbs light. The rest of the visual proteins are also tightly packed into the microvillar space, leaving little room for cytoplasm.

The photoreceptors in Drosophila express a variety of rhodopsin isoforms. The R1-R6 photoreceptor cells express Rhodopsin1 (Rh1), which absorbs blue light (480 nm). The R7 and R8 cells express a combination of either Rh3 or Rh4, which absorb UV light (345 nm and 375 nm), and Rh5 or Rh6, which absorb blue (437 nm) and green (508 nm) light respectively. Each rhodopsin molecule consists of an opsin protein covalently linked to a carotenoid chromophore, 11-cis-3-hydroxyretinal.[25]

Expression of Rhodopsin1 (Rh1) in photoreceptors R1-R6

As in vertebrate vision, visual transduction in invertebrates occurs via a G protein-coupled pathway. However, in vertebrates the G protein is transducin, while the G protein in invertebrates is Gq (dgq in Drosophila). When rhodopsin (Rh) absorbs a photon of light its chromophore, 11-cis-3-hydroxyretinal, is isomerized to all-trans-3-hydroxyretinal. Rh undergoes a conformational change into its active form, metarhodopsin. Metarhodopsin activates Gq, which in turn activates a phospholipase Cβ (PLCβ) known as NorpA.[26]

PLCβ hydrolyzes phosphatidylinositol (4,5)-bisphosphate (PIP2), a phospholipid found in the cell membrane, into soluble inositol triphosphate (IP3) and diacylgycerol (DAG), which stays in the cell membrane. DAG or a derivative of DAG causes a calcium selective ion channel known as TRP (transient receptor potential) to open and calcium and sodium flows into the cell. IP3 is thought to bind to IP3 receptors in the subrhabdomeric cisternae, an extension of the endoplasmic reticulum, and cause release of calcium, but this process doesn't seem to be essential for normal vision.[26]

Calcium binds to proteins such as calmodulin (CaM) and an eye-specific protein kinase C (PKC) known as InaC. These proteins interact with other proteins and have been shown to be necessary for shut off of the light response. In addition, proteins called arrestins bind metarhodopsin and prevent it from activating more Gq. A sodium-calcium exchanger known as CalX pumps the calcium out of the cell. It uses the inward sodium gradient to export calcium at a stoichiometry of 3 Na+/ 1 Ca++.[27]

TRP, InaC, and PLC form a signaling complex by binding a scaffolding protein called InaD. InaD contains five binding domains called PDZ domain proteins, which specifically bind the C termini of target proteins. Disruption of the complex by mutations in either the PDZ domains or the target proteins reduces the efficiency of signaling. For example, disruption of the interaction between InaC, the protein kinase C, and InaD results in a delay in inactivation of the light response.

Unlike vertebrate metarhodopsin, invertebrate metarhodopsin can be converted back into rhodopsin by absorbing a photon of orange light (580 nm).

Approximately two-thirds of the Drosophila brain is dedicated to visual processing.[28] Although the spatial resolution of their vision is significantly worse than that of humans, their temporal resolution is approximately ten times better.

Flight

The wings of a fly are capable of beating at up to 220 times per second. Flies fly via straight sequences of movement interspersed by rapid turns called saccades. During these turns, a fly is able to rotate 90 degrees in fewer than 50 milliseconds.

It was long thought that the characteristics of Drosophila flight were dominated by the viscosity of the air, rather than the inertia of the fly body. This view was challenged by research in the lab of Michael Dickinson, which indicated that flies perform banked turns, where the fly accelerates, slows down while turning, and accelerates again at the end of the turn, suggesting that inertia is the dominant force, as is the case with larger flying animals.[29][30] However, subsequent work showed that while the viscous effects on the insect body during flight may be negligible, the aerodynamic forces on the wings themselves actually cause fruit flies' turns to be damped viscously.[31]

See also

References

  1. ^ Meigen JW (1830) (in German) (PDF). Systematische Beschreibung der bekannten europäischen zweiflügeligen Insekten. (Volume 6). Schulz-Wundermann. https://dlib.stanford.edu:6521/text1/dd-ill/insekten6.pdf. 
  2. ^ Η Πύλη για την ελληνική γλώσσα
  3. ^ a b Eric C. R. Reeve, ed. (2001-06-23). "Drosophila melanogaster: The Fruit Fly". Encyclopedia of genetics. USA: Fitzroy Dearborn Publishers, I. pp. 157. ISBN 978-1-884964-34-3. http://books.google.com/?id=JjLWYKqehRsC&pg=PA157&lpg=PA157&dq=drosophila+eggs+day+lifetime. Retrieved 2009-07-01. 
  4. ^ "FlyBase: A database of Drosophila genes and genomes". Genetics Society of America. 2009. http://flybase.bio.indiana.edu/. Retrieved August 11, 2009. 
  5. ^ a b c d e f g Ashburner M, Thompson JN (1978). "The laboratory culture of Drosophila". In Ashburner M, Wright TRF. The genetics and biology of Drosophila. 2A. Academic Press. 1–81. 
  6. ^ a b c d e f g Ashburner M, Golic KG, Hawley RS (2005). Drosophila: A Laboratory Handbook. (2nd ed.). Cold Spring Harbor Laboratory Press. pp. 162–4. ISBN 0-87969-706-7. 
  7. ^ Bloomington Drosophila Stock Center at Indiana University: Basic Methods of Culturing Drosophila
  8. ^ a b Chiang HC, Hodson AC (1950). "An analytical study of population growth in Drosophila melanogaster". Ecological Monographs 20 (3): 173–206. doi:10.2307/1948580. JSTOR 1948580. 
  9. ^ Bakker K (1961). "An analysis of factors which determine success in competition for food among larvae of Drosophila melanogaster". Archives Neerlandaises de Zoologie 14: 200–281. 
  10. ^ Pitnick S (1996). "Investment in testes and the cost of making long sperm in Drosophila". American Naturalist 148: 57–80. doi:10.1086/285911. 
  11. ^ Houot, B.; Svetec, N.; Godoy-Herrera, R.; Ferveur, J. -F. (2010). "Effect of laboratory acclimation on the variation of reproduction-related characters in Drosophila melanogaster". Journal of Experimental Biology 213 (Pt 13): 2322. doi:10.1242/jeb.041566. PMID 20543131.  edit
  12. ^ Gilbert SF (2006). "9: Fertilization in Drosophila". In 8th. Developmental Biology. Sinauer Associates. ISBN 978-0-87893-250-4. http://8e.devbio.com/article.php?ch=9&id=87. 
  13. ^ a b c d Price C et al. (1999). "Sperm competition between Drosophila males involves both displacement and incapacitation". Nature 400 (6743): 449–452. Bibcode 1999Natur.400..449P. doi:10.1038/22755. PMID 10440373. 
  14. ^ a b Pierce, Benjamin A (2004). Genetics: A Conceptual Approach (2nd ed.). W. H. Freeman. ISBN 978-0-7167-8881-2. 
  15. ^ a b Adams MD, Celniker SE, Holt RA, et al. (2000). "The genome sequence of Drosophila melanogaster". Science 287 (5461): 2185–95. Bibcode 2000Sci...287.2185.. doi:10.1126/science.287.5461.2185. PMID 10731132. http://www.sciencemag.org/cgi/content/abstract/287/5461/2185. Retrieved 2007-05-25. 
  16. ^ Azpiazu N, Frasch M (1993). "tinman and bagpipe: two homeo box genes that determine cell fates in the dorsal mesoderm of Drosophila". Genes and Development 7 (7b): 1325–1340. doi:10.1101/gad.7.7b.1325. PMID 8101173. 
  17. ^ "NCBI (National Center for Biotechnology Information) Genome Database". http://www.ncbi.nlm.nih.gov/genome/?term=drosophila%20melanogaster. Retrieved 2011-11-30. 
  18. ^ Halligan DL, Keightley PD (2006). "Ubiquitous selective constraints in the Drosophila genome revealed by a genome-wide interspecies comparison". Genome Research 16 (7): 875–84. doi:10.1101/gr.5022906. PMC 1484454. PMID 16751341. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1484454. 
  19. ^ Carvalho, AB (2002). "Origin and evolution of the Drosophila Y chromosome". Current Opinion in Genetics & Development 12 (6852): 664–668. doi:10.1016/S0959-437X(02)00356-8. 
  20. ^ Reiter, LT; Potocki, L; Chien, S; Gribskov, M; Bier, E (2001). "A Systematic Analysis of Human Disease-Associated Gene Sequences In Drosophila melanogaster". Genome Research 11 (6): 1114–1125. doi:10.1101/gr.169101. PMC 311089. PMID 11381037. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=311089. 
  21. ^ Bier lab (2008). "Homophila: Human disease to Drosophila disease database". University of California, San Diego. http://superfly.ucsd.edu/homophila. Retrieved August 11, 2009. 
  22. ^ a b Katrin Weigmann, Robert Klapper, Thomas Strasser, Christof Rickert, Gerd Technau, Herbert Jäckle, Wilfried Janning & Christian Klämbt (2003). "FlyMove – a new way to look at development of Drosophila". Trends in Genetics 19 (6): 310–311. doi:10.1016/S0168-9525(03)00050-7. PMID 12801722. 
  23. ^ Gilbert S.F. (2000). Developmental Biology. 6th edition. Sunderland (MA): Sinauer Associates; 2000. 
  24. ^ Hardie RC, Raghu P (2001). "Visual transduction in Drosophila". Nature 413 (6852): 186–93. doi:10.1038/35093002. PMID 11557987. 
  25. ^ Nichols R, Pak WL (1985). "Characterization of Drosophila melanogaster rhodopsin". Journal of Biological Chemistry 260 (23): 12670–4. PMID 3930500. 
  26. ^ a b Raghu P, Colley NJ, Webel R, et al. (2000). "Normal phototransduction in Drosophila photoreceptors lacking an InsP(3) receptor gene". Molecular and Cellular Neuroscience 15 (5): 429–45. doi:10.1006/mcne.2000.0846. PMID 10833300. 
  27. ^ Wang T, Xu H, Oberwinkler J, Gu Y, Hardie R, Montell C, et al. (2005). "Light activation, adaptation, and cell survival Functions of the Na+/Ca2+ exchanger CalX". Neuron 45 (3): 367–378. doi:10.1016/j.neuron.2004.12.046. PMID 15694299. 
  28. ^ Rein, K. and Zockler, M. and Mader, M.T. and Grubel, C. and Heisenberg, M. (2002). "The Drosophila Standard Brain". Current Biology 12 (3): 227–231. doi:10.1016/S0960-9822(02)00656-5. PMID 11839276. 
  29. ^ Caltech Press Release 4/17/2003
  30. ^ S. Fry and M. Dickinson (2003). "The aerodynamics of free-flight maneuvers in Drosophila". Science 300 (5618): 495–8. Bibcode 2003Sci...300..495F. doi:10.1126/science.1081944. PMID 12702878. 
  31. ^ T. Hesselberg and F.-O. Lehmann (2007). "Turning behaviour depends on frictional damping in the fruit fly "Drosophila"". The Journal of Experimental Biology 210 (Pt 24): 4319–34. doi:10.1242/jeb.010389. PMID 18055621. 

Further reading

Gilbert S.F. (2000). Developmental Biology. 6th edition. Sunderland (MA): Sinauer Associates; 2000. 

Popular media

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

References and More Information

Supplement 1

Supplement 1

This is an update of Chapter 2 of Ashburner, Golic and Hawley, 2005. With permission of Cold Spring Harbor Press.

Drosophila DATABASES and THE LITERATURE

1. DATABASES

Several developments in the last decade or so have conspired to make databases of scientific information essential for biological research.  These include the explosive growth of DNA sequencing, the increasing availability of very large experimental data sets as well as the exponential growth of the conventional scientific literature.  Databases not only allow convenient access to these resources, but also, if they are well designed, allow links between classes of data that would be very difficult to establish manually.

There are many electronic databases that are essential for Drosophila researchers.  These include the large internationally collaborative databases of nucleic acid sequences and proteins (i.e. the DDBJ/EMBL-Bank/Genbank, Swiss-Prot/UniProt and PSD databases), the comprehensive community database for Drosophila, FlyBase, and a number of smaller resources that will be referenced below.

1.1     FlyBase

1.1.1  Introduction

FlyBase is the community database for Drosophila researchers.  It is one of several Model Organism Databases that provide information for a variety of experimental organisms.  FlyBase was established in 1992, and was primarily motivated by the need to provide continuity to the long established tradition in this field of publishing catalogs of mutations and chromosome aberrations. On its inception in 1992 FlyBase inherited the content of Lindsley and Zimm’s then recent revision of the Redbook  and incorporated this, along with the contents of the published bibliographies of Drosophila research into a relational database structure. 

FlyBase is a curated database.  Much of the information contained within FlyBase is obtained from the scientific literature, which is read and abstracted by FlyBase curators.  Information is also derived from other databases (e.g., the nucleic acid and protein sequence databases) and from large scale datasets provided by the community, including the Drosophila genome projects.  No database is perfect and FlyBase suffers from errors of commission and omission. For this reason FlyBase encourages community feedback, e.g., by email to flybase-help@morgan.harvard.edu.

Unlike some other model organism databases FlyBase was fortunate enough to establish a very intimate association with groups sequencing the genome of Drosophila.  From 1996, the bioinformatics parts of both the Berkeley and European Drosophila Genome Projects were integral members of the FlyBase consortium.

1.1.2  Other Drosophila databases.

In addition to FlyBase there are a number of other, more specialist, databases that are of interest to Drosophila researchers.  The more important of these are listed on the "Resources" pages of FlyBase.

2 LITERATURE

The first known publication on drosophilidsdates from 1684.  Since then approximately 80,000 substantive publications and about 30,000 abstracts have been published on these organisms. This is a substantial literature.

The existence of comprehensive databases for Drosophila should not obscure the fact that the great majority of researches with this organism are published conventionally in the scientific literature.  Searching for information from databases is most profitable when combined with reading the primary written sources.  Abstracts of the literature from about 1963 are often available from MEDLINE and PUBMED, and these are freely available resources (http://www.ncbi.nlm.nih.gov/PubMed/).  An increasing proportion of the current, and some of the older, literature is now available in electronic form.  FlyBase provides a convenient access to the Drosophila literature through its references query page.

2.1 HISTORICAL AND BIOGRAPHICAL ACCOUNTS

The only comprehensive history of the early days of Drosophila research is that by Kohler (1994).  A biography of T.H. Morgan, the founder of the field, was written by Allen (1978).  In addition to these there are a number of other biographical or historical books of interest to drosophilists, as well as many journal papers, especially in the “Perspectives” section of the journal Genetics.

  • Carlson, E.A. (ed.) 1968. Herman Joseph Muller. A Memorial Tribute. The Review, Indiana Univ. 11: 1-48.
  • Land, B. 1973. Evolution of a scientist: the two worlds of Theodosius Dobzhansky,pp. 262. Crowell, New York.
  • Allen, G.E. 1978.  Thomas Hunt Morgan. The Man and his Science, pp. 447. Princeton University Press, Princeton, NJ.
  • Carlson, E.A. 1981. Genes, Radiation, and Society. The Life and Work of H.J. Muller, pp. 457. Cornell University Press, Ithica and London.
  • Vorontsov, N.N. 1983. Nikolai Vladimirovich Timofeev-Resovskii. Ocherki, vospominaniia, materially. pp. 394. Nauka, Moskva. [In Russian.]
  • Provine, W.R. 1986. Sewall Wright and Evolutionary Biology, pp. 545. Chicago University Press, Chicago.
  • Shine, I. and S. Wrobel. 1976. Thomas Hunt Morgan, Pioneer of Genetics, pp. 160. The University Press of Kentucky. Lexington.
  • Granin, D. (trans. A.W. Bouis). 1990. The Bison. A novel about the scientist who defied Stalin, pp. 262. Doubleday, New York. [The life of N.V. Timofeeff-Ressovsky]. [First published in Russian as Zubr: povest’ in Novyi mir in 1987; also published as a novel in Russian (1988; Moskva, Sovetskii Pisatel’ and in German as Der Genetiker : das Leben des Nikolai Timofejew-Ressowski (1988; Pahl-Rugenstein, Koln.)]
  • Kohler, R.E. 1991. Drosophila and evolutionary genetics. Hist. Sci. 29: 335-375.
  • Paul, D.B. and C.B. Krimbas. 1992. Nikolai V. Timofeeff-Ressovsky. Scient. Am. February 1992: 86--92 .
  • Adams, M.B. (ed.) 1994. The evolution of Theodosius Dobzhansky: Essays on his life and thought in Russia  and America, pp. 249. Princeton University Press, Princeton, NJ.
  • Kohler, R.E. 1994. Lords of the fly: Drosophila genetics and the experimental life, pp. 321. Chicago University Press, Chicago, IL.
    Jacob, F. 1997. La souris, la mouche et l'homme.  Odile Jacob, Paris [translated by G. Weiss, 1998. Of flies, mice and men. Harvard
    University  Press, Cambridge, MA.]
  • Gehring, W.J. 1998. Master control genes in development and evolution: The homeobox story, pp. 236. Yale University Press, New Haven, CT.
  • Weiner, J. 1999. Time, love and memory: a great biologist and his quest for the origins of behavior, pp. 290. A.A. Knopf, New York. [Largely devoted to the work of Seymour Benzer.]
  • Timofeeff-Ressovsky, N.V. 2000. Vospominaniia : istorii, rasskazannye im samim, s pis'mami, fotografiiami i dokumentami. [The Stories told by Himself with Letters, Photos and Documents.]  pp. 876. Soglasie, Moskva. [In Russian.]
  • Brookes, M. 2001. Fly: an experimental life, pp. 215. Weidenfeld and Nicolson, London. [German translation 2002 published by Rowohlt, Reinbek.]
  • Babkov, V.V. and E.S. Sakanian. 2002. Nikolai Vladimirovich Timofeev-Resovskii. 1900-1981. pp. 672. Pamiatniki istoricheskoi mysli, Moskva. [In Russian.]
  • Lipshitz, H.D. 2004. Genes, Development and Cancer. The Life and Work of Edward B. Lewis. Kluwer Academic Publishers, Boston.
  • Novitski, E. 2005. Sturtevant & Dobzhansky. Two Scientists at Odds, With a Student's Recollections. pp. 241. Privately published by the Xlibris Corporation (www.Xlibris.com).

2.2     BIBLIOGRAPHIES

The Drosophila literature is vast, over 80,000 papers have been published to date and the rate of increase is now over 200 papers a month. 

  • Indexed bibliographies to the Drosophila literature were published for the years until 1981 and are reasonably complete, especially for the genetical literature, although less so for the taxonomic literature and for that concerned with drosophilids other than Drosophila itself. 
  • To 1924      Morgan, T.H., C.B. Bridges, and A.H. Sturtevant. 1925. The genetics of Drosophila. Bibliographica Genetica II: 1262. (~500 References, not indexed.)
  • 192539     Muller, H.J. 1939. Bibliography on the genetics of Drosophila. Imperial Bureau of Animal Breeding and Genetics. Oliver and Boyd, Edinburgh. (2965 References indexed in Part II.)
  • 193950     Herskowitz, I.H. 1953. Bibliography on the genetics of Drosophila. Part II. Commonwealth Bureau of Animal Breeding and Genetics, Farnham Royal, England. (2841 References, indexed; also includes the index of Part I.)
  • 195156     Herskowitz, I.H. 1958. Bibliography on the genetics of Drosophila. Part III. Indiana University Publications, Bloomington, Indiana. (3100 References.)
  • 195762     Herskowitz, I.H. 1963. Bibliography on the genetics of Drosophila. Part IV. McGraw-Hill Book Co., New York. (3305 References.)
  • 196367     Herskowitz, I.H. 1969. Bibliography on the genetics of Drosophila. Part V. The Macmillan Co., New York. (3775 References.)
  • 196872     Herskowitz, I.H. 1974. Bibliography on the genetics of Drosophila. Part VI. Collier-Macmillan Co., New York. (4821 References.)
  • 197378     Herskowitz, I.H. 197480. Bibliography on the genetics of Drosophila Part VII.  Drosophila Information Service  1974, 51: 159193; 1977, 52: 186226; 1978,  53: 219244; 1980, 55: 218262; 1980, 56: 198258. The indices are in the last section (DIS 56). (6684 References.)
  • 197881     Herskowitz, I.H. 198283. Bibliography on the genetics of Drosophila. Part VIII. Drosophila Information Service 1982,  58: 227270; 1983, 59: 162256. The indices are in the second section (DIS 59). (4174 References.)
    1. FlyBase. The bibliography of Drosophila 1982-1993. Drosophila Information Service 1994, 74: 1-675. (24245 References).
    2. FlyBase. The bibliography of Drosophila 1982-1994 (Supplement). Drosophila Information Service 1997, 79: 141-208. (2426 References).
    3. FlyBase. The bibliography of Drosophila 1994-1996. Drosophila Information Service 1997, 79: 211-399. (6402 References).

 3       Drosophila INFORMATION SERVICE

Drosophila Information Service (DIS) is an informal publication that was founded by Calvin Bridges in 1934, being modeled on the Maize Cooperative Newsletter. It includes research notes, stock lists, lists of new mutations, technical notes, a directory of drosophilists, and, often, bibliographies. It usually appears every year and is currently available for a modest charge from the editor, Dr. J.N. Thompson Jr (Department of Zoology, 730 Van Vleet Oval, University of Oklahoma, Norman, Oklahoma   73019, USA).  E. Novitski, who was editor for many years, reissued all but the ephemera of DIS 114 and DIS 1524 in single volumes. Back issues of DIS may be available from the editor.

DIS is in the process of making their issues available electronically from their WWW site at http://www.ou.edu/journals/dis/

4        Drosophila BULLETIN BOARD

The electronic bulletin board for Drosophila researchers is a useful way of contacting the community to announce meetings, request materials or ask for information.  The address for postings is dros@net.bio.net.  Note that postings are moderated so as to eliminate spam or irrelevant material.  The bulletin board is available from http://www.bio.net/hypermail/dros/.  This site has an archive of postings back to 1993.

2/5     Drosophila RESEARCHERS

A directory of Drosophila researchers is available from FlyBase.  Individual researchers must add – and maintain – their own contact details.

2/6     INTRODUCTIONS TO Drosophila

There have been several introductions to Drosophila, usually aimed at undergraduate teaching. The first of these was published as early as 1918 (Genetics Laboratory Manual by E.B. Babcock and J.L. Collins, McGraw-Hill, New York, pp. 56) and was presumably based on experience at Berkeley.                                          

  • Haskell, G. 1961. Practical heredity with Drosophila, pp. 124. Oliver & Boyd, Edinburgh.
  • Strickberger, M.W. 1962. Experiments in genetics with Drosophila, pp. 143. Wiley & Sons, New York.
  • Shorrocks, B. 1972. Drosophila, pp. 144. Ginn & Co., London.
  • Demerec, M. and B.P. Kaufman, with revisions by A.C. Spradling. 1996. Drosophila: Introduction to the genetics and cytology of Drosophila melanogaster, pp. 46. 10th edition. Carnegie Inst. Wash. Publ., Washington, D.C. [available for download from
    http://carnegieinstitution.org/books_in_print.html]
  • Graf, U., N. van Schaik and F.E. Würgler. 1983. Drosophila-Genetik, pp. 291. Springer-Verlag, Berlin and New York.
  • Graf, U., N. van Schaik and F.E. Würgler. 1992. Drosophila genetics: a practical course. pp. 239.  Springer Verlag, Berlin & New York. [English translation of Graf et al. 1983.]
  • Ramos Morales, P. 1993. Manual de laboratorio de genetica para Drosophila melanogaster. pp. 131. McGraw-Hill, Mexico City.
    Tyler, M.S. and J.W. Schnetzer. 1996. Fly cycle2: The Lives of a Fly, Drosophila melanogaster. Video. Sinauer Associates, Sunderland, MA.
  • Greenspan, R.J. 2004. Fly Pushing. The Theory and Practice of Drosophila Genetics, 2nd edition. pp.191. Cold Spring Harbor Press, Cold Spring Harbor, NY.
  • Tyler, M.S. and R.N. Kozlowski. 2003. Fly Life Cycle: The Lives of a Fly, Drosophila melanogaster. Video. Sinauer Associates, Sunderland, MA.

2/7     GENERAL MONOGRAPHS

In addition to the first and current editions of this work, there are three publications in English reviewing the biology or genetics (or both) of Drosophila in broad terms:

  • Morgan, T.H., C.B. Bridges, and A.H. Sturtevant. 1925. (see above). This is a very thorough review of all of the early genetics and includes much biological information, in addition to the genetics.
  • Demerec, M. (ed.) 1950. The biology of Drosophila, pp. 632. John Wiley, New York. Reprinted in 1965 by Hafner Publishing Co., New York and in 1994 by the Cold Spring Harbor Press. This remains an essential work of reference for any serious fly lab.
  • Ashburner, M., E. Novitski, T.R.F. Wright, H.L. Carson, and J.N. Thompson. (eds.) 19761986. The genetics and biology of Drosophila, vols. 1ac, 2ad, 3ae. Academic Press, London. An attempt at a reasonably comprehensive review of the biology of Drosophila.

The Novosibirsk group has written three monographs in Russian:

  • Khvostova, V.V., L.I. Korochkin, and M.D. Golubovsky. (eds.) 1977. Problemi genetiki Issledovania na Drosophila, pp. 278. Nauka, Moscow.
  • Khvostova, V.V., M.D. Golubovsky, and L.I. Korochkin. (eds.) 1978. Drosophila v experimentalnoy genetika, pp. 268. Nauka, Moscow.
  • Golubovsky, M.D. and L.I. Korochkin. (eds.) 1981. Biochimicheskaya genetik Drosophila, pp. 246. Nauka, Moscow.

A comprehensive monograph, Drosophila: A Laboratory Handbook was first published in 1989. The current edition is:

  • Ashburner, M., Golic, K. and Hawley, R.S. 2005. Drosophila: A Laboratory Handbook.  2nd edition. pp.1409. Cold Spring Harbor Press, New York.

8        METHODS BOOKS

Several “methods” books have been published in the last 15 years or so and are useful sources for both genetic, molecular, developmental and other techniques .

  • Ashburner, M. 1989.  Drosophila: A Laboratory Manual, pp. 434. Cold Spring Harbor Press, Cold Spring Harbor, NY.
  • Roberts, D. (ed.) 1986. Drosophila: A practical approach. pp. 310. IRL Press, Oxford.
  • Goldstein, L.S.B. and E.A. Fryberg (eds.) 1994. Drosophila melanogaster: Practical Uses in Cell Biology and Molecular Biology. Methods Cell Biol. 44: 1-755.
  • Roberts, D. (ed.) 1998. Drosophila: A practical approach, pp. 389. 2nd edition. Oxford University Press, Oxford.
  • Sullivan, W., M. Ashburner and R. Scott Hawley. (eds.) 2000. Drosophila Protocols, pp. 697. Cold Spring Harbor Press, Cold Spring Harbor, NY.
  • Dahamm, C. 2008. Drosophila. (Methods in Molecular Biology). pp. 400. Humana Press., Totowa, NJ.

9        MONOGRAPHS

There are a number of monographs and conference proceedings dealing with one or more aspects of Drosophila biology.

9.1     General

  • Sturtevant, A.H. 1961. Genetics and Evolution. Selected papers of A.H. Sturtevant, pp.334. Selected by E.B. Lewis. W.H. Freeman and Co., San Francisco.
  • Muller, H.J. 1962. Studies in genetics; the selected papers of H.J. Muller, pp. 618. Indiana University Press, Bloomington, IA.
  • Stern, C. 1968. Genetic Mosaics and Other Essays, pp.185. Harvard University Press, Cambridge, MA Proceedings of the Sixth European Drosophila Research Conference. 1980. pp. 231. Yugoslav Union Biological Sciences, Beograd. (Also as Acta Biol. Yugoslavica Series F, 12: 1231.)
  • Lakovaara, S. (ed.) 1982. Advances in genetics, development and evolution of Drosophila, pp. 470. Proceedings of the 7th European Drosophila Research Conference. Plenum Press, New York.

9.2     Developmental and Cell Biology

  • Strasburger, E.H. 1935. Drosophila melanogaster Meig. Eine Einführung in den Bau und die Entwicklung, pp. 60. Julius Springer, Berlin.
  • Poulson, D.F. 1937. The embryonic development of Drosophila, pp. 51. Actualités Scientifiques et Industrielles 498. Hermann et Cie., Paris.
  • King, R.C. 1970. Ovarian development in Drosophila melanogaster, pp. 227. Academic Press, New York.
  • Ursprung, H. and R. Nöthiger (eds.) 1972. The biology of imaginal disks. Results and problems in cell differentiation, vol.5, pp. 172. Springer-Verlag, Berlin, Heidelberg, and New York.
  • Dickerson, W.J. and D.T. Sullivan. 1975. Gene-enzyme systems in Drosophila. Results and problems in cell differentiation, vol.6, pp. 163. Springer-Verlag, Berlin, Heidelberg, and New York.
  • Siddiqi, O., P. Babu, L.M. Hall, and J.C.Hall. (eds.) 1980. Development and neurobiology of Drosophila. Proceedings of Conference on Development and Behavior of Drosophila, pp. 496. Tata Institute for Fundamental Research, Bombay, 1979. Plenum Press, New York.
  • Ransom, R. (ed.) 1982. A handbook of Drosophila development, pp. 289. Elsevier Biomedical Press, Amsterdam.
  • Lawrence, P.A. 1992. The making of a fly: the genetics of animal design, pp. 228. Blackwell’s  Scientific, Oxford & Boston.
  • Bate, M. and A. Martinez-Arias. (eds.) 1993. The Development of Drosophila melanogaster, 2 vols. pp. 1558. Cold Spring Harbor Press, Cold Spring Harbor, NY.
  • Hartenstein, V. 1993. Atlas of Drosophila development, pp. 57. Cold Spring Harbor Press, Cold Spring Harbor, NY.
  • Lasko, P.F. 1994. Molecular genetics of Drosophila oogenesis, pp. 125. R.G. Landes Co., Austin, TX.
  • Yamamoto, D. 1996. Molecular dynamics in the developing Drosophila eye. pp.172. R.G. Landes Co., Austin TX.
  • Campos-Ortega, J.A. and V. Hartenstein. 1997. The embryonic development of Drosophila melanogaster, pp. 405. 2nd edition. Springer-Verlag, Berlin.
  • Held, L.I. 2002. Imaginal discs: the genetic and cellular logic of pattern  formation. pp.460. Cambridge University Press, New York & Cambridge.

9.3 Neurobiology

  • Siddiqi, O., P. Babu, L.M. Hall, and J.C.Hall (eds.) 1980. Development and neurobiology of Drosophila. Proceedings of Conference on Development and Behavior of Drosophila, pp. 496. Tata Institute for Fundamental Research, Bombay, 1979. Plenum Press, New York.
  • Hall, J.C., R.J. Greenspan, and W.A. Harris. 1982. Genetic neurobiology, pp. 284. Massachusetts MIT Press, Cambridge.
  • Hall, J.C. 1982. Genetics of the nervous system of Drosophila. Quart. Rev. Biophysics 15: 223379.
  • Heisenberg, M. and R. Wolf. 1984. Vision in Drosophila, pp. 250. Springer-Verlag, Berlin.
  • Budnik. V. and L.S. Gramates. 1999. Neuromuscular Junctions in Drosophila. Int. Rev. Neurobiol. 43: 1-289.
  • Moses, K. 2002. (ed.) Drosophila Eye Development. Results and Problems in Cell Differentiation 37.  pp. 282. Springer, New York.
  • Hall, J.C. 2003. Genetics and molecular biology of rhythms in Drosophila and other Insects. pp. 286. Academic Press, San Diego, CA.
  • Muder, A. and T.A. Newman (eds) 2008. Drosophila. A toolbox for the study of neurodegenerative disease. Society of Experimental Biology, 60th Symposium. pp. 172. Taylor & Francis, London.

9.4 Tissue Culture

  • Echalier, G. 1997. Drosophila cells in culture, pp. 702. Academic Press, San Diego.

9.5 Aging

  • Lints, F.A. 1977. Aging in Drosophila, pp. 179. Irvington Press, New York.
  • Gartner, L.P. 1986. Aging in Drosophila: A selected annotated bibliography, pp. 247. Jen House Publishing Co., Baltimore.
  • Lints, F.A. and M.H. Soliman. (eds.) 1988. Drosophila as a model organism for ageing studies, pp. 307. Blackie & Son Ltd., Glasgow.

9.6 Genomics

  • Maroni, G. 1993. An atlas of Drosophila genes: sequences and molecular features. pp. 415.  Oxford University Press, New York and Oxford.
  • Arkhipova, I.R., N.V. Liubomirskaia and Y.V., Ilyin. 1995.  Drosophila retrotransposons. pp. 234. R.G. Landes Co., Austin, TX.
  • Hartl, D.L. and E.R. Lozovskaya. 1995. The Drosophila genome map: A practical guide. pp. 240. R.G. Landes Co., Austin TX.
  • Ashburner, M. 2006. Won for All. How the Drosophila Genome was Sequenced.  pp.107. Cold Spring Harbor Press, New York.

9.7     Chromosomes

  • Ananiev, E.V. and V.E. Barsky. 1985. Electron microscopic map of the polytene chromosomes of the salivary glands of Drosophila (D. melanogaster), pp. 85. Nauka, Moscow. [In Russian.]
  • Sorsa, V. 1988. Polytene chromosomes in genetic research, pp. 289. Ellis Horwood, Chichester, England.
  • Sorsa, V. 1988.  Chromosome maps of  Drosophila, 2 volumes, pp. 149 and 200. CRC Press, Boca Raton, FL. [available online at http://www.helsinki.fi/~saura/EM/index.html]
  • Khvostova, V.V. 1992. Effect polozhenyiya gena v issledovaniyakh V. V. Khvostovoy [Position effect variegation  researches of V. V. Khvostova]. pp. 98. Novosibirsk. [In Russian.]
  • Krimbas, C.B. and J.R. Powell. 1992. Drosophila inversion polymorphism, pp. 560. CRC Press, Boca Raton, FL.
  • Henderson, D.S. 2004. Drosophila cytogenetics protocols. pp.400. Human Press, Totowa, NJ.

9.8 Taxonomy, Evolution, Population Genetics and Ecology

  • Patterson, J.T. and W.S. Stone. 1952. Evolution in the genus Drosophila, pp. 610. The Macmillan Co., New York.
  • Okada, T. 1968. Systematic study of the early stages of Drosophilidae, pp. 168. Bunka Zugeisha Co., Tokyo.
  • Parsons, P.A. 1973. Behavioural and ecological genetics: A study in Drosophila, pp. 223. Clarendon Press, Oxford.
  • Lewontin, R.C., J.A. Moore, W.B. Provine and B. Wallace. (eds.) 1981. Dobzhansky’s Genetics of Natural Populations, I-XLIII. pp. 942. Columbia University Press, NY.
  • Gibson, J.B. and J.G. Oakeshott. (eds.) 1981. Genetic studies of Drosophila populations, pp. 267. Proceedings of the Kioloa Conference. Australian National University Press, Canberra.
  • Barker, J.S.F. and W.T. Starmer. (eds.) 1982. Ecological genetics and evolution. The Cactus-Yeast-Drosophila model system, pp. 362. Academic Press, Sydney.
  • Suzuki, K. (ed.). 1988. Selected papers by Dr Toyohi Okada (1936-1988). pp. 412. Toyama-shi, Japan.
  • Barker, J.S.F., W.S. Starmer and R.J. MacIntyre (eds.) 1990. Ecological and Evolutionary Genetics of Drosophila, pp. 524. Plenum Press, NY.
  • Krimbas, C.B. 1993.  Drosophila subobscura. Biology, genetics and inversion Polymorphism, pp. 395. Verlag Dr. Kovac, Hamburg.
  • Tobari, Y.N. (ed.) 1993. Drosophila ananassae. Genetical and biological aspects, pp. 289. Japan Scientific Societies Press, Tokyo.
  • Lee, T.J. 1993. [Evolution in Drosophila], pp. 330. Chung-ang University Press. [In Korean.]
  • Powell, J.R. 1997. Progress and Prospects in Evolutionary Biology: The Drosophila Model, pp. 562. Oxford University Press, New York & Oxford.
  • Markow, T.A. and P.M. O'Grady. 2006. Drosophila. A guide to species identification and use. pp. 259. Elsevier, Amsterdam.

2/10   PUBLISHED CATALOGS OF MUTATIONS

The mutations, and other genetic variants, of  D. melanogaster  were first systematically cataloged by Morgan, Bridges, and Sturtevant (1925) (see 2/1). In 1936, Bridges devoted all of DIS 9 to a draft list of mutations that became Bridges and Brehme (1942), the standard work of reference until the mid-1960s. Then Lindsley and Grell published a “revision” of Bridges and Brehme.  In fact, it is far more than a simple revision of the earlier work and covers the literature until 1965.  The final book in this series is Lindsley and Zimm (1992), which differed from all previous books in centering attention on genes, rather than mutations.  Lindsley and Zimm, universally know as “The Red Book” covers the literature until the end of 1989. 

  • Bridges, C.B. and K.S. Brehme. 1942.  The mutants of  Drosophila melanogaster, pp. 252. Carnegie Inst. Wash. Publ.  552.
  • Braver, N.B. 1956.  The mutants of  Drosophila melanogasterclassified according to body parts affected , pp. 36. Carnegie Inst. Wash. Publ.  552A.
  • Lindsley, D.L. and E.H. Grell. 1968.  Genetic variations of  Drosophila melanogaster, pp. 472. Carnegie Inst. Wash. Publ.  627.
  • Lindsley, D.L. and G.G. Zimm, G.G. 1992. The Genome of Drosophila Melanogasterpp.  1133. Academic Press, San Diego.

2/11   Drosophila RESEARCH CONFERENCES

Drosophila Research Conferences are held every year in North America and every other year in Europe and Japan.  The North American meetings are organized by the Drosophila Board, an elected body which is playing an increasingly active role in the field.  The European Drosophila Research Conferences and, since 1986, the North American Drosophila meetings publish books of abstracts of papers and posters presented.  Electronic versions of the abstracts of the North American Conferences are available since 1998 on FlyBase.  Information concerning these meetings can be obtained from any active fly laboratory.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Catalogs of the family Drosophilidae

World.

  • Wheeler, M.R.. 1981. The Drosophilidae: A taxonomic overview. In The genetics and biology of Drosophila (ed. M. Ashburner et al.), 3a: 1-97. Academic Press, London and New York.
  • Wheeler, M.R. 1986. Additions to the catalog of the world's Drosophilidae. In The genetics and biology of Drosophila (ed. M. Ashburner et al.), 3e: 395-409. Academic Press, London and Orlando.
  • Brake, I.R. and G. Bächli. 2008. World Catalog of Drosophilidae (Diptera: Schizophora). In Press.

Palaearctic

  • Bächli, G. and M.T. Rocha Pité. 1984. Family Drosophilidae. In Catalogue of Palaearctic Diptera (ed. A. Soós and L. Papp), 10: 186-220. Akadémiai Kiadó, Budapest.

Afrotropical

  • Tsacas, L. 1980. Family Drosophilidae. In Catalogue of the Diptera of the Afrotropical region (ed. R.W. Crosskey), pp. 673-685. British Museum (Nat. Hist.), London.

Nearctic

  • Wheeler, M.R. 1965. Family Drosophilidae. In A catalog of Diptera of North America (ed. A. Stone et al.), pp. 760-772. United States Department of Agriculture, Washington, D.C.

Neotropical.

  • Wheeler, M.R. 1970. Family Drosophilidae. In A catalogue of the Diptera of the Americas south of the United States. Fasc. 79: 1-65.

Oriental

  • Okada, T. 1977. Family Drosophilidae. In A catalog of the Diptera of the Oriental region (ed. M.D. Delfinado and D.E. Hardy), III: 342-387. University Press, Hawaii, Honolulu.

Australasia & Oceania

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Research Resources

In addition to the large public collections of mutant strains of D. melanogaster (above) there are many public resources available. A current list of these is maintained on the "Resources" pages of FlyBase.

Living strains of species of drosophilid other than D. melanogaster are available from the Drosophila Species Stock Center in Tucson, AZ.                      

Tissue culture cell lines, DNA clones and other reagents are available from the Drosophila Genomics Resource Center in Bloomington, IN.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Editor's Links

The primary web resource for information concerning Drosophila is FlyBase. FlyBase is a community database for Drosophila genetics and genomics, supported by funding from the National Human Genome Research Institute of the National Institutes of Health.  FlyBase is freely available. FlyBase includes a "Resources" page, which lists the very many other many web resources for Drosophila.

A second major resource which integrates data from Drosophila with those from other model research organisms is FlyMine.

A web resource for the taxonomy and distribution of Drosophilidae is Taxodros maintained by Dr. G. Bächli. The Japan Drosophila Database makes many of the classical taxonomic papers on Drosophilidae available as PDF files.

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Additional Resources

FlyBase keeps a current bibliography whose aim is to be complete with respect to all publications concerning the family Drosophilidae. This includes over 70,000 references.  FlyBase is willing to supply copies of a reasonable number of papers to researchers from an extensive reprint collection they hold. They reserve the right to refuse this service, which is primarily aimed at giving access to old, hard to find, papers and to giving access to papers to those in the lesser developed parts of the world.

Books.  There are many monographs of various aspects of Drosophila biology. The standard comprehensive monograph is:

  • Ashburner, M., Golic, K. and Hawley, R.S., 2005, Drosophila: A Laboratory Handbook. 2nd edition. Cold Spring Harbor Press, New York. ISBN:0879697067.

A current elementary introduction to Drosophila genetics is:

  • Greenspan, R. 2004. Fly Pushing. The Theory and Practice of Drosophila Genetics. 2nd edition. Cold Spring Harbor Press, New York. ISBN:0879697113.

A more complete account of the Drosophila literature is to be found in the Supplement Section (under References and More Information).

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

People

A directory of Drosophila researchers in kept by FlyBase and can be queried.  General help about Drosophila may be sent to the appropriate BIONET bulletin board (see http://www.bio.net/biomail/listinfo/dros) and specific help about genetic or genomic topics by email to FlyBase (email: flybase-help@morgan.harvard.edu).

Creative Commons Attribution 3.0 (CC BY 3.0)

Michael Ashburner

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!