Molecular Biology and Genetics

Molecular Biology

Barcode data: Drosophila simulans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCGCGACAATGATTATTTTCTACAAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAGCTTGAGCTGGAATAGTCGGAACATCATTAAGAATTTTAATTCGAGCCGAATTAGGTCATCCTGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTCGGAAATTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTACTACCCCCTGCTCTTTCTTTATTATTAGTAAGAAGAATAGTTGAAAACGGAGCTGGAACAGGATGAACTGTTTATCCACCTTTATCTGCTGGAATTGCCCACGGAGGAGCTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTCTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATGCGATCAACAGGAATTTCATTAGATCGTATACCTTTATTTGTTTGATCAGTAGTTATTACTGCTTTATTATTACTATTATCATTACCAGTATTAGCGGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCAGCTGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGGATAATTTCTCATATTATTAGACAAGAATCAGGGAAAAAGGAAACTTTTGGTTCTTTAGGAATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTCACAGTCGGGATAGACGTAGATACACGAGCTTATTTCACTTCAGCTACTATAATTATTGCAGTTCCTACTGGTATTAAAATTTTTAGCTGATTAGCTACTTTACATGGAACTCAACTTTCTTATTCTCCAGCTATTTTATGAGCTTTAGGATTTGTATTTTTATTCACAGTAGGAGGATTAACAGGAGTTGTTTTAGCTAATTCATCAGTAGATATTATTTTACATGATACTTATTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCTGTATTTGCTATTATAGCAGGTTTTATTCATTGATACCCTTTATTTACTGGATTAACATTAAATAATAAATGATTAAAAAGTCAATTTATTATTATATTTATTGGAGTAAATTTAACATTTTTCCCTCAACATTTTTTAGGATTAGCTGGAATACCTCGACGATACTCAGATTATCCAGATGCTTACACAACATGAAATATTGTGTCTACTATTGGATCAACTATTTCATTATTAGGAATTCTATTCTTTTTTTTTATTATTTGAGAAAGTTTAGTATCACAACGGCAAGTAATTTATCCAATTCAATTAAATTCATCTATTGAATGATACCAAAATACTCCACCAGCTGAACATAGATATTCTGAATTACCACTATTAACAAATTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Drosophila simulans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 90
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Drosophila simulans

Drosophila simulans is a species of fly closely related to D. melanogaster and which belongs to the same melanogaster species subgroup. Its closest relatives are D. mauritiana and D. sechellia. This species was discovered by the fly geneticist Alfred Sturtevant in 1919, when he noticed that the flies used in Thomas Hunt Morgan's laboratory at the Columbia University were actually two distinct species: D. melanogaster and D. simulans. Males differ in the external genitalia, while trained observers can separate females using colour characteristics. D. melanogaster females crossed to D. simulans males produce sterile F1 females and no F1 males. The reciprocal cross produces sterile F1 males and no female progeny.

D. simulans was found later to be closely related to two island endemics, Drosophila sechellia and Drosophila mauritiana. D. simulans will mate with these sister species to form fertile females and sterile males, a fact that has made D. simulans an important model organism for research into speciation.

Studies have obtained evidences that paternal leakage is an integral part of the inheritance of this species.[1]

References[edit]

  • Sturtevant, A.H. 1919. A new species closely resembling Drosophila melanogaster. Psyche 26: 153–155.
  • Sturtevant, A.H. The North American Species of Drosophila. Carnegie Institute of Washington, 1921.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!