Ecology

Associations

Flowering Plants Visited by Scathophaga stercoraria in Illinois

Scathophaga stercoraria Linnaeus: Scathophagidae, Diptera
(observations are from Graenicher and Anderson & Hill)

Asteraceae: Leucanthemum vulgare sn/fp (Gr); Hamamelidaceae: Hamamelis virginiana sn/fp (AH)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / pathogen
Entomophthora muscae infects dead adult of Scathophaga stercoraria

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scathophaga stercoraria

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBDP0467-06|AF104625|Scathophaga stercoraria| CGACAATGGTTATTTTCTACTAATCATAAAGATATTGGAACATTATACTTTATTTTCGGAGCATGATCCGGAATAATTGGAACTTCTTTA---AGTATTCTAATTCGAGCTGAATTAGGACATCCTGGAGCATTAATTGGAGAT---GACCAAATCTATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTGCCTCTTATA---TTAGGTGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCACCAGCATTAACTTTATTGTTAGTAAGTAGTATAGTAGAAAACGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTATCTTCAAATATTGCTCATGGAGGAGCTTCTGTTGATTTA---GCAATTTTTTCTCTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCAACAGGAATTACTTTTGATCGAATACCTTTATTTGTATGATCTGTAGTAATTACAGCTTTATTACTTTTATTATCTTTACCTGTTTTAGCTGGA---GCTATTACTATACTATTAACAGATCGAAATCTTAATACATCATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTCTATATCAACATTTATTTTGATTTTTTGGACACCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATTATTAGTCAAGAATCAGGTAAAAAG---GAAACATTCGGATCTTTAGGAATAATTTATGCTATATTAGCTATTGGTTTATTAGGATTTATTGTATGAGCTCATCACATATTTACTGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Scathophaga stercoraria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 22
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Scathophaga stercoraria

Scathophaga stercoraria, known as the common yellow dung fly or sometimes called the golden dung fly. It is one of the most familiar and abundant of flies in many parts of the northern hemisphere. As its common name suggests, it is often found on mammal faeces, most notably those of horses and cows.

Contents

Description

From 5 mm to 11 mm in length. The adult males of Scathophaga stercoraria are bright golden-yellow with orange-yellow fur on the front legs. Females are a little duller in colour, with pronounced green-brown tinges, and lacking the bright coloured fur on the fore legs. It is a very variable species, and part of this may be climate driven.[1]

Biology

The adults are mostly predators on smaller insects — mostly other Diptera, they will also feed on pollen, but most specimens seen on flowers will be hunting prey there. Both males and females are found on dung, the males only feeding on other insects that visit dung, such as blow-flies. Females will be there both to feed and oviposit on the dung surface,

Females prefer to lay their eggs on the small hills of the dung surface and avoid depressions and pointed parts of the dung. This ensures survival, as emergence is better by avoiding the drying on small points in the dung. Also by avoiding possible drowning by rain by not laying eggs in depressions of the dung surface. The female yellow dung-fly is capable of making these decisions about her egg placement, and thus increasing possibility of success of her future generations.[2] The eggs hatch into predatory larvae and feed on insect larvae within the dung. After 21 days or more of feeding, dependent on conditions, the larvae burrow into the soil around and beneath the dung and then develop into pupae, before developing into adult flies.

Scathophaga stercoraria can produce four or five generations per season. The adults are active throughout much of the year in most moderate climates. In most cases both males and females will mate multiple times, as is very common in insects. Much has been studied about the competition between genders and what factors determine mating success, and what part that in turn may play on the competitive nature on the larvae.[3]

Parasites and diseases

Sexually transmitted diseases of insects are known, particularly in Coleoptera and have also been studied in Scathophaga stercoraria. Many of these sexually transmitted diseases are from multicellular ectoparasites (mites), protists or the fungi Entomophthera muscae. These are frequently responsible for ether sterilising or killing the host fly.[4]

Predators

Beside being an easy meal for a great many bird and bat species, they are also preyed upon by other insects. Among these are the Irish robberfly Machimus cowini and the dune robberfly Philonicus albiceps.[5]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!