Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bactrocera tryoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bactrocera tryoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGACAATGGCTATTCTCAACAAATCATAAAGATATTGGAACTTTATATTTTATCTTCGGAGCCTGAGCAGGTATAGTCGGAACATCCCTTAGAATTTTAGTCCGAGCTGAACTAGGACATCCCGGAGCATTAATCGGAGAC---GATCAGATTTATAATGTAATTGTAACAGCCCATGCTTTCGTAATGATTTTCTTTATAGTTATACCAATTATAATTGGTGGTTTCGGAAACTGGCTTGTTCCTTTAATATTAGGTGCACCCGATATAGCATTCCCACGAATAAATAATATAAGATTTTGGTTACTACCCCCTTCCCTTACACTACTATTAGTGAGAAGTATAGTAGAAAACGGAGCTGGTACAGGTTGAACAGTTTACCCACCCCTATCGTCTGTTATTGCACACGGAGGGGCTTCAGTTGATTTAGCTATTTTCTCACTTCACTTAGCTGGTATCTCATCGATTTTAGGAGCAGTAAATTTCATTACAACAGTTATTAATATACGATCTACAGGAATTTCGTTTGACCGAATACCTCTTTTCGTTTGAGCAGTTGTATTAACAGCCCTGTTACTTTTACTATCATTGCCAGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAACTTAAATACCTCCTTTTTTGACCCTGCTGGGGGAGGAGATCCTATTCTTTACCAACACTTATTTTGATTCTTTGGACATCCANNNNNTTATATTTTATTTCTTCCAGGATTCGGAATAATTTCTCATATTATTAGTCAAGAGTCAGGAAAAAAGGAAACATTTGGATCTCTAGGAATAATTTATGCTATGATAGCAATTGGCTTATTAGGATTTATTGTATGAGCTCACCATATATTCACAGTAGGTATAGATGTAGACACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bactrocera tryoni

The Queensland fruit fly (Bactrocera tryoni) is a species of tephritid fruit fly native to Australia.

Adult flies are about 5 to 8mm in length in adult stage. Their larvae hatch in various fruit species, causing significant damage to crops.[1]

The fly has been the subject of extensive control regimes including a Fruit Fly Exclusion Zone where it is forbidden to take fruit, and post-harvest dipping of fruit in dimethoate and fenthion. As of October 2011, the use of these chemicals was under review by the Australian Pesticides and Veterinary Medicines Authority (APVMA), with dimethoate suspended from use.[2] In May 2012 and January 2013, the fly was found in Auckland, posing a risk to agriculture and leading to a quarantine.[3]

The white locus[edit]

A gene for white eye found in Drosophila is found to have homologs in this as well as numerous other Diptera.[4]

References[edit]

  1. ^ Tri-state fruit fly program website
  2. ^ Chemical review: dimethoate on APVMA website
  3. ^ Chapman, Kate; Robinson, Victoria. "Fly breach blamed on relaxed security". stuff.co.nz. Fairfax Media. Retrieved 13 May 2012. 
  4. ^ Gomulski, L. M., Pitts, R. J., Costa, S., Saccone, G., Torti, C., Polito, L. C., Gasperi, G., Malacrida, A. R., Kafatos, F. C., Zwiebel, L. J. Genomic Organization and Characterization of the white Locus of the Mediterranean Fruitfly, Ceratitis capitata Genetics 2001 157: 1245-1255 Full text

Further reading[edit]

  • Courtice, A. C. (2006). Of Peaches and Maggots, The Story of Queensland Fruit Fly. Published by Hillside Books.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!