Overview

Comprehensive Description

Ceratitis anonae Graham, 1908

Ceratitis (Pterandrus) anonae Graham
Ceratitis anonae Graham, 1908: 114.
Body length: 5.06 (4.35-5.90) mm; wing length: 5.15 (4.45-5.75) mm.

Male
Head:
Antenna yellow. First flagellomere three times as long as pedicel. Arista with short to moderately long rays; ventral rays shorter and sparser than dorsal rays, especially basally. Frons pale, sometimes completely yellow, center yellow; with short scattered setulae distinctly darker than frons. Frontal setae well developed. Face white, sometimes yellowish white. Genal seta and setulae dark, well developed. Thorax:
Postpronotal lobe white, sometimes yellowish white; without spot. Scutal pattern:
ground color ash-gray; with streaks and darker markings but without distinct spots or clearly defined stripes except prescutellar white markings separate, sometimes with pale area in between. Scapular setae dark. Scutellum white, sometimes yellowish white, basally without spots, apically with three separate black spots, extending to basal 0.33, sometimes only to basal half. This has a strage meaning. The measurment should relate to apical 0.66 or 0.5 (global) I am not sure, the spots are apical spots reaching ‘forwards’ towards the basal margin. In some species they will reach the basal margin of the scutellum, in others only till halfway (‘basal half’ or ‘apical half’, whatever you choose), still in others till basal third. Referring this forward extension in relation to the apical length, sound a bit strange to me. I would therefore prefer to keep it in relation to the basal margin. However, if you feel very strongly about the apical aspect, you can still do a global change as such. Anepisternum on ventral 0.33-0.5 brown; setulae pale. Legs:
Yellow except where otherwise noted; setation typical for subgenus, mainly dark. Foreleg:
femur dark anteriorly along entire dorsal margin, posteriorly along dorsal 0.66, with poorly developed bush of dispersed long dark setulae along entire length, posterodorsal setulae longer; ventral setae dark. Midleg:
femur largely brownish black, anteriorly with silvery shine when viewed from certain angle, only distal end pale; ventrally with dark feathering along entire length, basally somewhat less dense; tibia broadened; largely brownish black with silvery shine when viewed from certain angle, with black feathering dorsally along distal 0.9 and ventrally along distal 0.8. Hindleg:
femur dark brown except distally, at apical 0.25 with longer setulae dorsally and ventrally. Wing:
Markings yellowish brown. Interruption between marginal and discal bands near vein R1 clear and complete; discal band often partly or completely interrupted in discal cell; cubital band free; medial band absent; crossvein R-M opposite middle of discal cell. Apex of vein R1 distal to level of crossvein R-M. Crossvein DM-Cu oblique anterobasally. Abdomen:
Mostly yellow. Border between tergite 1 and 2 narrowly black. Tergites 2 and 4 with pale gray band occupying almost entire tergite, at most narrowly yellow anteriorly. Tergite 3 with distinct brownish black band along posterior half; rarely interrupted medially. Tergite 5 with basal 0.33 brownish, usually divided medially into two spots; posteriorly narrowly brownish.
Male epandrium in lateral view with lateral surstylus curved, posterior lobe short.
Female
As male except following characters. Anepisternal pilosity on ventral 0.33 partly dark, especially centrally. Legs without feathering; femora yellow, forefemur posteriorly, and midfemur and hindfemur anteriorly on basal 0.66 often with brownish streaks; sometimes femora completely yellowish brown; forefemur posteroventrally with dark pilosity. Wing with discal band complete. Oviscape shorter than preabdomen. Aculeus at most six times as long as wide; tip with distinct apical indentation and lateral margin slightly sinuous.
(Description after De Meyer & Freidberg, 2006)
See description of Ceratitis anonae Graham, 1908 in source PDF.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Marc de Meyer, MRAC

Source: Afrotropical Fruitfly Project

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Ceratitis anonae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Ceratitis anonae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CAACAATGGCTATTTTCAACTAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAGCATGAGCTGGAATAGTAGGAACATCTCTTAGAATTTTAATCCGAGCTGAATTAGGTCACCCAGGAGCACTAATTGGAGAT---GACCAAATTTATAATGTAATTGTTACTGCTCATGCTTTCGTAATAATTTTTTTTATAGTTATNCCTATTATAATNGGAGGGTTNGGAAATTGACTAGTACCTTTAATACTNGGNGCTCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCTCTTACATTATTATTAGTAAGTAGTATAGTAGAAAANGGAGCTGGAACAGGTTGAACAGTTTACCCTCCCCTTTCTTCTGTAATTGCCCATGGAGGGGCTTCTGTTGACTTAGCAATTTTTTCTCTTCACTTAGCAGGAATTTCTTCTATTTTAGGAGCTGTAAATTTTATTACNACAGTAATTAATATGCGATCAACTGGAATTTCATTTGACCGTATACCTTTATTTGTCTGAGCTGTAGTTCTTACTGCATTATTATTATTACTTTCTCTTCCAGTTTTAGCGGGAGCTATTACAATATTATTAACAGACCGAAATTTAAATACGTCATTCTTTGACCCAGCAGGAGGAGGNGATCCTATTTTATACCNACACTTATTTTGATTTTTTGGACATCCTGAAGTATATATTTTAATTCTACCTGGATTCGGAATAATTTCTCATATTATTAGTCAAGAATCAGGGAAAAAGGAAACATTCGGATCATTAGGGATAATTTATGCTATATTAGCAATTGGTTTATTAGGATTTATTGTTTGAGCACATCATATATTTACAGTTGGTATAGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!