Ecology

Associations

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea

In Great Britain and/or Ireland:
Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea nigra
Other: major host/prey

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea nigra var. nemoralis

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea aspera

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea cyanus

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea calcitrapa

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea jacea

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea scabiosa

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea solstitialis

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Centaurea paniculata
Remarks: Other: uncertain

Foodplant / gall
larva of Urophora quadrifasciata causes gall of capitulum of Serratula tinctoria

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Urophora quadrifasciata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAACAATGGTTATTTTCAACAAATCATAAAGATATCGGAATTTTATATTTTATTTTTGGTATTTGATCAGGAATAATTGGTACATCCTTAAGAATTTTAATTCGTGCAGAATTAGGTCATCCAGGAGCATTAATTGGAAAT---GATCAAATTTATAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAATTCCTATTATATTAGGAGCACCTGATATAGCTTTTCCACGAATAAATAATATAAGTTTTTGATTATTACCTCCATCTCTTTCATTATTGTTAGTTAGAAGAATAGTAGAAAATGGAACTGGAACTGGTTGAACAGTATATCCACCTTTATCATCAATTATTGCTCATAATGGACCATCAGTTGATTTAGCTATTTTTTCATTACACTTAGCAGGAATTTCATCTATTATAGGAGCAGTAAATTTTATTACTACCGTAATTAATATACGATCTACAGGAATTACTTTTGATCGAATACCTTTATTTGTTTGAGCAGTTATATTAACTGCTATTTTACTTTTATTATCATTACCAGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTTTGATTTTTTGGTCATCCANNNNNTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTAGACAAGAATCTGGAAAAAAAGAAACATTTGGTTCATTAGGAATAATTTATGCAATGATAGCAATTGGATTATTAGGTTTTATTGTATGAGCACATCATATATTTACAGTAGGAATAGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Urophora quadrifasciata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Urophora quadrifasciata

Urophora quadrifasciata is a species of tephritid or fruit flies in the genus Urophora of the family Tephritidae.[1][2][3] The host plant for the larvae is usually a knapweed (Centaurea sp).[4]

References

  1. ^ [1]
  2. ^ quadrifasciata
  3. ^ http://data.gbif.org/species/browse/taxon/13143053
  4. ^ Ian M, White, Tephritid Flies, Diptera: Tephritidae, Handbooks for the Identification of British Insects, page 63, vol 10, part 5a, Royal Entomological Society of London, 1988


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!