Overview

Comprehensive Description

Ceratitis caetrata Munro, 1949

Ceratitis (Ceratitis) caetrata Munro
Ceratitis (Ceratitis) caetrata Munro, 1949: 499.
Body length: 4.02 (3.90-4.20) mm; wing length: 4.31 (4.00-4.65) mm.

Male
Head. Antenna yellow. Third antennal segment twice as long as second segment. Arista with short hairs. Frons yellow, inflated above antennal implant; almost bare, at most with few short scattered hairs which are largely the same colour as frons. Ocellar and orbital bristles yellow; lower orbital modified, apical end dark and fan shaped, at least twice as long as arista; upper orbital much reduced, weakly developed. Frontal bristles absent. Face yellow-white. Genal bristle pale, genal setulae dark reddish, weakly developed. Postocellar and outer vertical bristles pale. Thorax. Postpronotum pale yellow, with distinct black spot. Mesonotum:
ground colour orange; microtrichiae pattern silvery with orange shine, spots brown or black-brown; sutural spots whitish, small; prescutellar whitish markings separate. Scapular setae pale. Scutellum yellow-white, basally with two dark separate spots, apically with three merged spots, incisions variable, at least till halfway and sometimes almost reaching apical bristles. Anepisternum completely pale. Legs. Yellow; setation typical for subgenus, mainly pale especially on femora. Fore femur posteriorly with bush of longer orange-coloured hairs along entire length, posterodorsal hairs longer; ventral spines yellow-orange; anteroventral row of hairs short and yellow. Hind femur with longer hairs dorsally and ventrally on apical fourth. Wing. Marginal band with clear and complete interruption; cubital band free; medial band absent; crossvein r-m at middle of discal cell. Vein R beyond crossvein r-m. Crossvein dm-cu posteriorly more outwards than anteriorly. Abdomen. Yellow. Setation and banding typical for subgenus.
Female
As in male except for the following characters:
Third antennal segment two to three times as long as second segment; yellow-orange. Frons yellow-orange, only slightly inflated; two frontal bristles present; short hairs more developed and distinctly darker than frons. Ocellars dark (frontal and orbitals presumably also but missing in specimens studied). Orbitals not modified (according original description). Genal setulae strongly developed. Mesonotal pattern sometimes much darker, more like in C. capitata. Crossvein dm-cu posteriorly more inwards. Legs without feathering. Oviscape shorter than abdominal terga.
(Description after De Meyer, 2000)
See description of Ceratitis caetrata Munro, 1949 in source PDF.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Marc de Meyer, MRAC

Source: Afrotropical Fruitfly Project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Holotype for Ceratitis caetrata Munro, 1948
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): N. Krauss
Year Collected: 1936
Locality: Nairobi; Brit. E. Afr, Unknown, Kenya
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ceratitis caetrata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CAACAATGGCTATTTTCAACTAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAGCATGAGCTGGAATAGTAGGAACATCCTTAAGAATTTTAATTCGAGCTGAATTAGGACATCCAGGAGCATTAATTGGAGAT---GATCAAATTTATAATGTAATTGTTACTGCCCATGCTTTTGTAATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATACTTGGAGCACCAGATATGGCATTTCCTCGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCCCTTACATTATTATTAGTAAGTAGTATAGTAGAAAATGGGGCTGGAACAGGTTGAACAGTTTACCCTCCTCTTTCTTCTGTGATTGCTCATGGTGGTGCTTCTGTTGACTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTGTAAATTTTATCACAACAGTAATTAATATACGATCTACCGGAATTTCATTCGACCGAATACCTTTATTTGTTTGAGCAGTAGTTCTTACTGCACTACTTCTATTATTATCTTTACCAGTTTTAGCAGGAGCTATCACTATATTATTAACAGATCGAAATTTAAATACTTCTTTCTTTGACCCAGCTGGAGGGGGAGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGGATAATTTCACATATTATTAGACAAGAATCAGGAAAAAAGGAAACTTTCGGTTCATTAGGAATAATTTATGCTATACTAGCTATTGGATTATTAGGATTTATTGTTTGAGCACACCATATATTTACAGTTGGTATAGACGTTGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ceratitis caetrata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!