Articles on this page are available in 1 other language: Portuguese (1) (learn more)

Overview

Comprehensive Description

Ceratitis capitata (Wiedemann, 1824)

Ceratitis (Ceratitis) capitata (Wiedemann)
Tephritis capitata Wiedemann, 1824: 55.
Body length: 4.00 (3.45-4.60) mm; wing length: 4.12 (3.65-4.55) mm.

Male
Head. Antenna yellow or more orange; first and second segment and base of third segment sometimes darker. Third antennal segment twice as long as second segment. Arista with short hairs, mainly on base and only distinct dorsally. Frons convex to flat; yellow, sometimes with darker orange or orange-brown patches including darker band near antennal implant, occasionally with faint silvery shine; with short scattered hairs which are largely the same colour as frons. Frontal and ocellar bristles black; lower orbital modified, stem pale and shorter than arista with apical end dark and diamond-shaped; upper orbital weakly developed, black. Face yellow-white. Genal bristle pale, genal setulae pale or reddish, weakly developed. Postocellar and outer vertical pale. Thorax. Postpronotum white, with distinct black spot. Mesonotum:
ground colour black, microtrichiae pattern silvery with ashgrey shine, spots black except sutural white spots, prescutellar white markings merged. Scapular setae pale. Scutellum yellow-white, basally with two dark spots, separate or narrowly touching, apically with three merged spots, only slightly incised. Anepisternum pale with lower half darker yellow, pilosity variable but at least partly dark in lower half. Legs yellow; setation typical for subgenus, mainly pale especially on femora. Fore femur posterodorsally with bush of longer orange-coloured hairs along entire length, basally these hairs darker red or brown but not distinct black; posteriorly hairs much shorter; ventral spines yellow-orange; anteroventral row of hairs short and yellow-orange. Hind femur with longer hairs dorsally and ventrally on apical fourth. Wing. marginal band usually with clear and complete interruption, occasionally narrowly or partly touching; cubital band free; medial band absent; crossvein r-m at or near middle of discal cell. Vein R beyond or equal with crossvein r-m. Orientation crossvein dm-cu variable. Abdomen. Yellow. Setation and banding typical for subgenus.
Female
As in male except for the following characters:
Third antennal segment in general darker than in male. Frons sometimes with darker hairs; darker patches never as outspoken as in male. Orbitals not modified, well developed. Genal setulae darker and strongly developed. Anepisternum without darker pilosity. Legs without feathering; ventral spines on fore femur sometimes partially dark. Oviscape shorter than abdominal terga.
(Description after De Meyer, 2000)
See description of Ceratitis capitata (Wiedemann, 1824) in source PDF.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Marc de Meyer, MRAC

Source: Afrotropical Fruitfly Project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The oldest populations of mediterranean fruit flies (a.k.a. medflies) can be traced back to the African tropics in the Ethiopian biogeographic region. This species is native to both the Ethiopian and Palearctic regions, and introduced populations have since been discovered in all of the biogeographic regions.

Transportation of fresh fruit by air (either commercially, or incidentally by travelers) has greatly increased the risk of accidental introduction of this species into other parts of the world, and strong efforts are made to prevent its spread.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

  • Copeland, R., R. Wharton, Q. Luke, M. Meyer. 2002. Indigenous Hosts of Ceratitis capitata (Diptera:Tephritidae) in Kenya. Annals of the Entomological Society of America, 95/6: 672-694. Accessed November 12, 2005 at http://www.bioone.org/bioone/?request=get-document&issn=0013-8746&volume=095&issue=06&page=0672.
  • Dekker, L., R. Messing. 2005. "Introduction to Managing Fruit Flies in Hawai'i" (On-line). http://www.extento.hawaii.edu. Accessed November 12, 2005 at http://www.extento.hawaii.edu/kbase/reports/fruit_pest.htm.
  • Thomas, M., J. Heppner, R. Woodruff, H. Weems, G. Steck. 2001. "Featured Creatures" (On-line). Accessed October 10, 2005 at http://creatures.ifas.ufl.edu/fruit/Mediterranean_fruit_fly.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The body of C. capitata is protected by an exoskeleton made of chitin. As in all insects, the body has three main segments: the head, thorax, and abdomen; as well as three pairs of legs. The oval-shaped abdomen is yellowish with two white bands. It is covered by black bristles. The thorax is whitish-yellow with patches of black. The eyes are reddish-purple, transforming to black within 24 hours of death. The single pair of wings is translucent and embellished with patterns of brown, yellow, black, and white.

Medflies exhibit sexual dimorphism in that females are larger than males and can be identified by a yellow wing pattern and pointed ovipositor (about 1.2 mm long) which is used to plant eggs within the host fruit. Males have more exaggerated features such as more brightly colored eyes, longer front legs, and a pair of supra-fronto-orbital bristles.

The white larvae, or maggots, are legless and may be up to 8 mm in length. Pupal length is about 4 mm and adults range from 3 to 5 mm, approximately two-thirds the size of a housefly. The wingspan of C. capitata was not available, but can be extrapolated from the wingspan of similar species. Oriental fruit flies, which have a body length of 6 to 8 mm, have a wingspan of 5.3 to 7.3 mm. Medflies, being slightly smaller in body size, probably have slightly shorter wingspans.

Range length: 3 to 5 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently; male more colorful

  • California Department of Food and Agriculture, 2005. "Mediterranean Fruit Fly Pest Profile" (On-line). Pest and Disease Information. Accessed October 10, 2005 at http://www.cdfa.ca.gov/phpps/pdep/mediterranean_ff_profile.htm.
  • Teparkum, S. 1998. "Pests of Mango" (On-line). Accessed October 10, 2005 at http://www.ento.vt.edu/Fruitfiles/mangoIPM/mangoIPM.HTM#Oriental%20fruit.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

In their native home range (sub-Saharan Africa), medflies are found in forests, open woodland in highland areas, and at the coast, shrublands, and dunes. Their dispersal across suboptimal habitats, such as areas where woody vegetation is dominant, is possible because of their ability to both exploit plants in dry habitats and their ability to migrate over moderate-to-substantial distances.

Ceratitis capitata hcan be found in agricultural areas where large quantities of fruit provide plenty of food. This species is widespread and may be found anywhere from sea level to mountainous areas (over 2,133 m in elevation). Its habitat use maybe be affected by other fruit fly species: when first introduced to Hawaii, medflies were found in the lowlands but since the subsequent introduction of the oriental fruit fly (Bactrocera dorsalis) in 1945, they are only found at higher elevations.

Range elevation: 0 to 2133 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Among the Tephritidae, medflies are the most polyphagous species. This means that they feed from the widest variety of host-fruits. Over 200 types of fruits and vegetables have been recorded as hosts for this parasitic species. Species consumed include fruits of the following plant families: Anacardiaceae, Cucurbitaceae, Loganiaceae, Meliaceae, Oleaceae, Podocarpaceae, Rosaceae, Rubiacaea, Sapotaceae and Solanaceae. Though preferences differ geographically, thin-skinned, slightly hard, ripe, and succulent fruits are desirable.

Adult (mature) and larval (immature) stages differ in their feeding habits. As mentioned under “Development”, larvae eat their way through the fleshy host fruit. At this immature stage, nutrition is essential and will determine adult size, time of development, and the percentage of larvae that emerge. Studies have shown that diets with higher concentrations of glucose and sucrose lead to better development than those containing high starch or maltose concentrations. Adult medflies require carbohydrates from the juices of ripe fruit, and protein from bird feces and decomposing fruit. Adults feed in mid-morning and late afternoon.

Adult medflies prefer the portion of the fruit in which there is more nutritive value. For example, the lower portions of orange and papaya fruits contain the bulk of the nutrition. If placed on the top portion of these fruits, a medfly will move to the lower part. In contrast, flies placed on the lower portion of the fruit remain there to feed.

Plant Foods: fruit; sap or other plant fluids

Other Foods: dung

Primary Diet: herbivore (Frugivore )

  • Demirel, N. 1999. "Behavioral Paradigms in the Mediterranean Fruit Fly, Ceratitis capitata (Weidemann)" (On-line). Accessed November 07, 2005 at http://www.colostate.edu/Depts/Entomology/courses/en507/papers_1999/demirel.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

In their natural environment, these flies are parasitic on host plants, but are not often harmful to plant populations. They may reduce seed dispersal by spoiling fruit, but they don't necessarily prevent seed germination. They are prey for a wide variety of insect predators and parasites. They are much more significant in agricultural ecosystems, where they can be a major pest of fruit crops (see below).

Ecosystem Impact: parasite

Species Used as Host:

Mutualist Species:

  • There are no known mutualists with this species.

Commensal/Parasitic Species:

  • wasps

  • Western Australian Department of Agriculture. Common Pests of Summer Fruit in Western Australia. Bulletin No 4585; ISSN 1448-0352. Western Australia: Western Australian Department of Agriculture. 2003. Accessed October 12, 2005 at http://agspsrv38.agric.wa.gov.au/pls/portal30/docs/FOLDER/IKMP/PW/INS/PP/HORT/BULLETIN4585.PDF.
  • Gillespie, P., B. McNeil. 1998. "Ceratitis capitata (Weidman)" (On-line). Fruit Flies of New South Wales. Accessed October 10, 2005 at http://www.agric.nsw.gov.au/Hort/ascu/fruitfly/ceratiti.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

These flies have no obvious structures or behaviors that are specifically related to defense against predators.

Medflies are attached by many parasitoid wasps. Some wasps (such as Diachasmimorpha tryoni and Diachasmimorpha longicaudata) are capable of hearing the larvae eating their way through the fruit. The wasp uses its ovipositor to inject an egg into the maggot. During the fly's pupation, the wasp larva will eat its host, killing the developing fly and emerging from the pupal case as an adult.

Many generalist predators of insects, such as ants, spiders, mantids, and assassin bugs will attack fruit flies. Birds, including chickens, will attack the larvae as they emerge from fruit, and some soil nematodes attack the larvae as the burrow and pupate.

Known Predators:

  • Adams, S. 1994. "Putting the bite on Caribbean fruit flies" (On-line). Accessed November 07, 2005 at http://www.ars.usda.gov/is/AR/archive/key2.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Male medflies use chemical, visual, acoustic, and behavioral (e.g. wing waving) signals in their sexual communication with females. See “Reproduction: Mating Systems” for information on both male-female and male-male (marking of leaves with chemical to stake out mating ground territory) communication. In addition to these communication pathways, it is likely that some tactile communication occurs during mating itself.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks ; vibrations

Perception Channels: visual ; ultraviolet; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Medflies undergo a complete metamorphosis, beginning life as larvae and transforming into completely different-looking adult fruit flies. Females lay their eggs approximately 1 mm beneath the skin of host fruit. Although each female lays only 2 to 10 eggs in a given fruit, multiple females may lay their eggs in the same location, so that the slim, smooth, white eggs, about 0.1 cm long, may be clustered together in a single spot of seventy-five or more.

After 1.5 to 3 days (longer if the temperature is lower) the eggs hatch. The larvae carve tunnels, eating their way through the fruit. Larval life may last a mere 6 to 10 days (when temperature is around 25ºC). Along with temperature, the type of host fruit affects the length of the larval stage. In citrus fruits, 14 to 26 days may be required to reach pupation. Development in a green peach is completed in 10 to 15 days.

There are three larval stages, or instars. In the first, larvae are slender, cream colored, translucent, and about 0.1 cm long. In the second instar, larvae are partly transparent, revealing the fruit in the gut. By the third instar, larvae are opaque white and 0.6 to 0.8 cm long. These larvae can be distinguished from other fruit fly larvae by their thoracic spiracles, with 7 to 11 small protruding tubules.

Most larvae begin to pupate at sunrise, an inch or two into the soil. The pupal stage lasts from 6 to 13 days at around 24.4ºC. This range significantly increases (possibly to about 19 days) when the temperature drops to around 20.5ºC. The pupal stage is resistant to temperature extremes and dessication,  so it may last much longer if conditions are not right for emergence. It is typical for the new adult medflies to surface on warm mornings. At this early adult stage, they are capable of flying short distances, and may disperse further distances via the wind.

Development - Life Cycle: metamorphosis

  • Mau, R., J. Kessing. 1992. "Ceratitis capitata (Weidmann)" (On-line). Accessed October 10, 2005 at http://www.extento.hawaii.edu/kbase/crop/Type/ceratiti.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Sources differ on the maximum lifespan of adult medflies, it may be six months or a year, though they agree that cool conditions with abundant food and water are necessary for the flies to survive this long. Most live much shorter lives, and in most populations at least half are dead in less than 60 days. On a normal diet of sugar and protein in laboratory settings, females tend to outlive males by approximately 1.5 days.

Typical lifespan

Status: wild:
20 to 60 days.

Average lifespan

Status: wild:
35 days.

Typical lifespan

Status: captivity:
30 to 65 days.

Average lifespan

Status: captivity:
45 days.

  • Carey, J., P. Liedo, L. Harshman, Y. Zhang, H. Mueller, L. Partridge, J. Wang. 2002. Life history response of Mediterranean fruit flies to dietary restriction. Aging Cell, (2002) 1: 140-148. Accessed November 13, 2005 at http://anson.ucdavis.edu/~mueller/agingcell.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Female medflies are fussy about their mates. Though the basis of a female's choice is not entirely understood by scientists, characteristic communications between the sexes are thought to play a role.

Male medflies claim their mating ground territories on individual leaves by depositing a pheromonal substance from the tip of the abdomen to the leaf. In addition, the male emits sounds by rapidly vibrating his wings while perched on the underside of his leaf.

Females watch this behavior from a distance of about 6 to 10 cm then begin to approach the male if he is deemed acceptable. As the female nears (within 3 to 5 mm) the male’s rapid wing flapping switches modes to what is called “fanning” in which he moves forward and backward, possibly to better direct the pheromones at the female. The male then proceeds with a side-to-side head motion. Slow motion analysis of the courtship shows female responses to the calling male. These inconspicuous responses, all occurring within 0.04 to 0.16 seconds, include touching the male with her head or front legs, jumping towards the male, short wing vibrations, and stretching just after mounting. A female may reject a male at any stage of the courtship sequence.

Males seek multiple mates (polygyny), whereas females tend to remate only if the initial mating was with a sterile male.

Mating System: polygynous

Adult medflies reach sexual maturity approximately five days after emerging from the pupal stage. Copulation occurs at any time of the day and both sexes are sexually active throughout the entire day. Medflies in tropical regions (warm temperatures year round) are capable of year-round breeding. A female medfly may lay up to 22 eggs per day, and possibly 800 eggs during her lifetime, though 300 is more typical. Because new eggs are constantly made throughout a female’s adult life, fecundity, or the number of eggs laid, is largely a function of the female’s lifespan.

Breeding interval: Female medflies usually mate once, then lay eggs over a period of several days or weeks before they die.

Breeding season: Medflies are capable of year-round breeding in tropical regions where the temperature remains warm. Otherwise, they breed during the warmer months of the year.

Range eggs per season: 200 to 800.

Average eggs per season: 300.

Range time to independence: 0 to 0 minutes.

Range age at sexual or reproductive maturity (female): 5 (low) days.

Range age at sexual or reproductive maturity (male): 5 (low) days.

Key Reproductive Features: semelparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous ; sperm-storing

Medflies do not provide care for their offspring after eggs have been laid. However, females do invest some resources in each egg, providing young with the nutrients and energy needed to hatch out as larvae.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

  • The Agricultural Research Agency of Israel. Acoustic Trap for Female Mediterranean Fruit Flies. Israel: State of Israel: Ministry of Agriculture and Rural Development. 2004. Accessed October 15, 2005 at http://www.agri.gov.il/AGEN/Reports/Mizrach001.html.
  • Mau, R., J. Kessing. 1992. "Ceratitis capitata (Weidmann)" (On-line). Accessed October 10, 2005 at http://www.extento.hawaii.edu/kbase/crop/Type/ceratiti.htm.
  • Thomas, M., J. Heppner, R. Woodruff, H. Weems, G. Steck. 2001. "Featured Creatures" (On-line). Accessed October 10, 2005 at http://creatures.ifas.ufl.edu/fruit/Mediterranean_fruit_fly.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ceratitis capitata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 108 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBDP0702-06|AJ242872|Ceratitis capitata| CAACAATGGCTATTTTCAACTAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAGCATGAGCTGGAATAGTAGGAACATCCTTA---AGAATTTTAATTCGAGCTGAATTAGGACATCCAGGAGCATTAATTGGAGAT---GATCAAATTTATAATGTAATTGTTACTGCCCATGCTTTTGTAATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATA---CTTGGAGCACCAGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCCCTTACATTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGTTGAACAGTTTACCCTCCTCTTTCTTCTGTGATTGCTCATGGAGGTGCTTCTGTTGACTTA---GCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGGGCTGTAAATTTTATCACAACAGTAATTAATATACGATCTACCGGAATTTCATTCGACCGAATACCTTTATTTGTTTGAGCAGTAGTTCTTACTGCACTACTTCTATTATTATCTTTACCAGTTTTAGCAGGA---GCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTCTTTGACCCAGCTGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTACATTTTAATTTTACCAGGATTTGGAATAATTTCACATATTATTAGACAAGAATCAGGAAAAAAG---GAAACTTTCGGTTCATTAGGAATAATTTATGCTATACTAGCTATTGGATTATTAGGATTTATTGTTTGAGCACACCATATATTTACAGTTGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ceratitis capitata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 107
Species: 152
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

This species is abundant around the world, and not considered in need of conservation. It is a pest, and the target of strong efforts to reduce its abundance and distribution.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Of all true fruit flies, medflies are the most rampant pest, attacking practically all with a fleshy fruit species. Economically, medflies impact humans by damaging crops and making the fruit unmarketable.

Fruit-growers and their governments around the world spend millions of dollars a year trying to control this pest and prevent it from spreading to new locations.

Negative Impacts: crop pest

  • International Atomic Energy Agency, 2003. "Defeating the Medfly" (On-line). IAEA Technical Co-operation: Building Development Partnerships. Accessed November 12, 2005 at http://www.iaea.org/Publications/Booklets/UndpBook/medfly.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive effects of Ceratitis capitata on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ceratitis capitata

Ceratitis capitata, the Mediterranean fruit fly, or medfly for short, is a species of fruit fly capable of causing extensive damage to a wide range of fruit crops. It is native to the Mediterranean area, but has spread invasively to many parts of the world, including Australasia and North and South America.

Contents

Life cycle

Larva of the medfly

Adult medflies lay their eggs under the skins of fruit, particularly where the skin is already broken. The eggs hatch within three days, and the larvae develop inside the fruit. The adults have a limited ability to disperse, but the global fruit trade can transport infected fruit over thousands of miles.

Invasions

In the United States, C. capitata has invaded four states (Hawaii, California, Texas and Florida), but has been eradicated from all but Hawaii. The medfly has been spotted in California as recently as mid September 2009.[1] It has also been eradicated from New Zealand and Chile.

California medfly crisis

Much research has been dedicated to means of controlling the medfly. In particular, use of the sterile insect technique has allowed the species to be eradicated from several areas.

In 1981, California Governor Jerry Brown, who had established a reputation as a strong environmentalist, was confronted with a serious medfly infestation in the San Francisco Bay Area. He was advised by the state's agricultural industry, and the US Department of Agriculture's Animal and Plant Health Inspection service (APHIS), to authorize airborne spraying of the region. Initially, in accordance with his environmental protection stance, he chose to authorize ground-level spraying only. Unfortunately, the infestation spread as the medfly reproductive cycle out-paced the spraying. After more than a month, millions of dollars of crops had been destroyed and billions of dollars more were threatened. Governor Brown then authorized a massive response to the infestation. Fleets of helicopters sprayed malathion at night, and the California National Guard set up highway checkpoints and collected many tons of local fruit; in the final stage of the campaign, entomologists released millions of sterile male medflies in an attempt to disrupt the insects' reproductive cycle.

Ultimately the infestation was eradicated, but both the Governor's delay and the scale of the action has remained controversial ever since. Some people claimed that malathion was toxic to humans, as well as insects. In response to such concerns, Brown's chief of staff, B. T. Collins, staged a news conference during which he publicly drank a small glass of malathion. Many people complained that, while the malathion may not have been very toxic to humans, the aerosol spray containing it was corrosive to car paint.

During the week of September 9, 2007, adult flies and their larvae were found in Dixon, California. The California Department of Food and Agriculture (CDFA) and cooperating county and federal agricultural officials started eradication and quarantine efforts in the area. Eradication was declared on August 8, 2008, when no "wild" (i.e. non-sterile) medflies were detected for three generations.

On November 14, 2008, four adult flies were found in El Cajon, California. The San Diego County Agricultural Commission implemented a treatment plan, including distributing millions of sterile male flies, local produce quarantines, and ground spraying with organic pesticides.[2]

Australia

In 2011, Japan banned imports of blueberries from Australia, because of "concerns they might be contaminated with Mediterranean fruit fly".[3]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!