Overview

Comprehensive Description

Biology

Occurs on or near the bottom of the upper continental slope at 298-850 m; viviparous with yolk-sac dependency; no reproductive and diet data are available, however, it is presumed that the species feeds on small fishes, cephalopods, and crustaceans (Ref. 58048). Trawled mainly in 300-400 m (Ref. 58443). Marketed for its meat, fins, and liver oil which is of high value (Ref. 58048).
  • Last, P.R., L.J. Marshall and W.T. White 2007 Squalus nasutus sp. Nov., a new long-snout spurdog of the 'japonicus-group' from the Inidan Ocean. pp. 83-90. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58443)   http://www.fishbase.org/references/FBRefSummary.php?id=58443&speccode=63590 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Australia and Indo-Australian Archipelago to the Philippines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Indian Ocean: Western Australia. Probably extending to Westerm Pacific, the Philippines and Indonesia.
  • Last, P.R., L.J. Marshall and W.T. White 2007 Squalus nasutus sp. Nov., a new long-snout spurdog of the 'japonicus-group' from the Inidan Ocean. pp. 83-90. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58443)   http://www.fishbase.org/references/FBRefSummary.php?id=58443&speccode=63590 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species was known as Squalus sp. E in Last and Stevens (1994). Known to occur on the continental slope off Western Australia at depths of 300 to 510 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

49.9 cm TL (male/unsexed; (Ref. 58443)); 59 cm TL (female)
  • Last, P.R., L.J. Marshall and W.T. White 2007 Squalus nasutus sp. Nov., a new long-snout spurdog of the 'japonicus-group' from the Inidan Ocean. pp. 83-90. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58443)   http://www.fishbase.org/references/FBRefSummary.php?id=58443&speccode=63590 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This small species of the ‘japonicus group’ has the following set of characters: very elongate body, depth 9.4-11.4% TL; narrow and long snout, preoral length 1.85-2.01 times its horizontal prenarial length, 11.1-11.7% TL; large eyes, 4.3-5.1% TL; secondary lobe of anterior nasal flap is well developed; small, raked dorsal fins; first dorsal-fin spine short, weak; second dorsal-fin spine short with strong base; pectoral fin of adult not falcate; pectoral-fin inner margin is short, 6.6-7.1% TL; caudal bar almost upright, short, broad, extending from the caudal fork to the posterior margin of the upper lobe for 0.4-0.5 of its length, upper caudal blotch is somewhat linear, and is located near the dorsal margin of fin lobe; flank denticles weakly tricuspidate; monospondylous centra 36-39, precaudal centra 78-81, total centra 103-109 (Ref. 58443).
  • Last, P.R., L.J. Marshall and W.T. White 2007 Squalus nasutus sp. Nov., a new long-snout spurdog of the 'japonicus-group' from the Inidan Ocean. pp. 83-90. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58443)   http://www.fishbase.org/references/FBRefSummary.php?id=58443&speccode=63590 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; marine; depth range 300 - 850 m (Ref. 58443), usually 300 - 400 m (Ref. 58443)
  • Last, P.R., L.J. Marshall and W.T. White 2007 Squalus nasutus sp. Nov., a new long-snout spurdog of the 'japonicus-group' from the Inidan Ocean. pp. 83-90. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58443)   http://www.fishbase.org/references/FBRefSummary.php?id=58443&speccode=63590 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The biology of this dogfish is essentially unknown. It occurs at depths of 300 to 510 m, and unlike most spurdogs, which occur in schools, appears to be solitary. It reaches at least 56 cm, with males maturing at around 50 cm.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Squalus nasutus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTACCGCCCTTAGCTTACTTATTCGAGCAGAATTAAGCCAACCTGGTTCTCTTCTGGGAGATGATCAAATCTATAATGTTATCGTAACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTGATGCCTGTAATAATCGGTGGGTTCGGAAACTGATTAGTACCTTTAATAATTGGTGCACCAGACATAGCTTTTCCACGAATAAATAATATAAGCTTTTGATTATTGCCTCCCTCCCTCCTGTTACTTCTAGCCTCTGCTGGTGTAGAAGCGGGAGCCGGAACCGGCTGAACAGTCTACCCCCCTCTCGCAGGTAATATAGCTCATGCTGGAGCATCCGTAGACCTAGCCATCTTCTCACTTCATTTGGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATTACAACTATTATTAACATAAAACCACCTGCTATTTCTCAGTATCAAACACCACTCTTTGTTTGATCCATCCTTGTAACCACTGTTCTTCTTCTTCTTTCTCTTCCTGTTCTCGCAGCTGCAATTACGATACTATTAACTGACCGTAATTTAAACACGACATTTTTTGATCCTGCTGGAGGGGGGGACCCAATTCTTTACCAACATTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Squalus nasutus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Cavanagh, R.D. & Lisney, T.J. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group (Shark Red List Authority)

Contributor/s

Justification
Little is known of the biology of this dogfish though it is likely to have the limiting life history characteristics similar to other deepwater shark species, thus will not be sufficiently fecund to withstand high levels of exploitation. It occurs on the continental slope off Western Australia with a depth range of 300 to 510 m. This area is subject to the North West Slope Trawl and Western Deepwater Trawl fisheries. Although there has been no assessment of the effect on the non-target bycatch species of these fisheries, which will likely include Squalus nasutus, fishing effort is small with only a few boats in operation. The lack of data on the species’ biology, extent of occurrence, population size, or any indicator of population trend warrants a Data Deficient assessment at this time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is currently no information on population or subpopulation size.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The area and depth range at which this species is known to occur falls within the North West Slope Trawl and Western Deepwater Trawl fishery areas. However, fishing effort is small with only a few boats in operation, and although details on bycatch are currently unavailable, given the low fishing effort, it is unlikely the impact is cause for concern for this species at the present time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently there are no conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western longnose spurdog

The western longnose spurdog, Squalus nasutus, is a dogfish of the family Squalidae, found on the continental shelf off the northwest and southwest coasts of Western Australia, at depths of between 300 and 510 m. Its length is at least 55 cm.

The western longnose is a rare, small and slender dogfish with a narrow head and long narrow snout. There is a short medial barbel on the anterior nasal flaps. The pectoral fin has a shallowly concave posterior margin. The first dorsal fin is moderately high with a short spine.[2]

Coloration is light grey above, paler below, with no white spots. The pale dorsal fins have dusky tips and posterior margins. There is a dark blotch on part of the caudal fin's posterior margin.[2]

Its reproduction is ovoviviparous.

See also

References

  1. ^ R. D. Cavanagh & T. J. Lisney (2003). "Squalus nasutus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/42726. Retrieved March 3, 2010.
  2. ^ a b Compagno, Dando, & Fowler, Sharks of the World, Princeton University Press, New Jersey 2005 ISBN 0-691-12072-2
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!