Overview

Distribution

Range Description

This species was known as Squalus sp. F in Last and Stevens (1994). Known to occur on the slope off Queensland, northeastern Australia, and also captured in trawls on the outer shelf and upper slope along the New South Wales coast.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Australia.
  • White, W.T., P.R. Last and J.D. Stevens 2007 Two new species of Squalus of the 'mitsukurii group' from the Indo-Pacific. pp. 71-81. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea: Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

60.2 cm TL (male/unsexed; (Ref. 58442)); 71.1 cm TL (female)
  • White, W.T., P.R. Last and J.D. Stevens 2007 Two new species of Squalus of the 'mitsukurii group' from the Indo-Pacific. pp. 71-81. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea: Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species is a moderate-sized one of the ‘mitsukurii group’ with the following set of characters: very elongate body, depth 10.1-12.6% TL; narrow, moderately long snout, preoral length 2.38-2.53 times its horizontal prenarial length, 10.5-11.3% TL, mouth width 1.54-1.77 (1.66) times its horizontal prenarial length; pre-first dorsal length is 28.9-31.3 (30.0)% TL; pre-second dorsal length is 60.2-62.7 (61.2)% TL; interdorsal space is 22.3-24.7 (23.8)% TL; dorsal fins are small, raked, first dorsal-fin height 6.3-7.2% TL; first dorsal-fin spine short and weak; second dorsal-fin spine slender with moderately broad base; prepectoral length 21.7-23.6 (22.4)% TL; pelvic-caudal space 24.0-26.5 (25.4)% TL; pectoral fin of adults slightly falcate; pectoral-fin inner margin relatively short, 7.1-7.8% TL; caudal bar almost upright, extending narrowly from the caudal fork up the posterior margin of the upper lobe for usually about 0.4 (rarely to 0.6) of its length in immature individuals, upper caudal fringe narrow, sometimes with a narrow central blotch on upper lobe; flank denticles are weakly tricuspidate; monospondylous centra 37-42, precaudal centra 80-87, total centra 105-116 (Ref. 58442).
  • White, W.T., P.R. Last and J.D. Stevens 2007 Two new species of Squalus of the 'mitsukurii group' from the Indo-Pacific. pp. 71-81. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea: Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The biology of this dogfish is essentially unknown. It occurs at depths of 120 to 500 m. Maximum total length of males is about 64 cm, and females 73 cm. Size at birth possibly about 22 cm; males mature by about 52 cm, and females about 63 cm. Litter sizes are usually between 3 and 5 pups (K Graham, pers. comm).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; marine; depth range 148 - 504 m (Ref. 58442), usually 220 - 450 m (Ref. 58442)
  • White, W.T., P.R. Last and J.D. Stevens 2007 Two new species of Squalus of the 'mitsukurii group' from the Indo-Pacific. pp. 71-81. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea: Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Squalus grahami

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATCTTTGGTGCATGAGCAGGTATAGTAGGTACCGCCCTTAGCTTACTAATTCGAGCAGAATTAAGCCAACCTGGTTCTCTTCTGGGAGATGATCAAATCTATAATGTTATCGTAACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTGATGCCTGTAATAATCGGTGGATTCGGAAACTGATTAGTACCTTTAATGATTGGTGCACCAGACATAGCTTTTCCACGAATAAATAATATAAGCTTTTGATTATTGCCTCCCTCCCTCCTGTTACTTTTAGCCTCTGCTGGTGTAGAAGCGGGAGCCGGAACCGGCTGAACAGTCTACCCCCCTCTCGCGGGTAATATAGCTCATGCTGGAGCATCCGTAGACCTGGCCATCTTCTCACTCCATTTGGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATTACAACTATTATTAACATAAAACCACCTGCTATTTCTCAGTATCAAACACCACTCTTTGTTTGATCCATCCTTGTAACCACAGTTCTTCTTCTTCTTTCTCTTCCTGTTCTCGCAGCCGCAATTACGATACTATTAACTGACCGTAATTTAAACACAACATTTTTTGATCCTGCGGGAGGGGGGGACCCAATTCTTTATCAACATTTANNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squalus grahami

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003
  • Needs updating

Assessor/s
Cavanagh, R.D. & Lisney, T.J. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Graham, K. & Fowler, S. (Shark Red List Authority)

Contributor/s

Justification
This deepwater dogfish would qualify for Critically Endangered based on application of the criteria to part of its range studied off New South Wales, Australia with documented declines of as much as 97% between 1976 to 1977 and 1996 to 1997. Indeed, almost all trawlable ground on the continental slope off central and southern New South Wales is regularly fished and is likely to be maintaining continual local pressure on this species. However, this area represents less than 20% of its known range, with the rest to the north where fishery threats are non-existent or minor. Thus Squalus grahami is assessed as Near Threatened, reflecting its wider distribution outside the heavily fished area. However, if specimens are found to occur in other areas exploited by fisheries, and if it is found to have the life history characteristics (low fecundity, slow growth and high longevity) typical of better known squalids, the situation must be reevaluated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is currently no information on population or subpopulation size.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Almost all trawlable ground on the slope off central and southern New South Wales is regularly fished maintaining continual fishing pressure on all species including Squalus grahami. A documented decline of approximately 97% of "greeneye dogsharks" (comprising Squalus mitsukurii and Squalus grahami) between 1976/77 and 1996/97 between the Sydney area (central New South Wales (NSW)) and the Eden-Gabo Island area (southern NSW/northern Victoria) was reported from a fishery independent survey (Graham et al. 2001). Total catches in the abovementioned areas in 220 to 605 m (i.e., much of the known depth range of the two species) declined from a mean of 44.8 kg/h in 1976/77 to a mean of 1.2 kg/h in 1996-97. In 1976/77 the two species were caught in approximately equal numbers off Sydney and Ulladulla, thus it is a fair assumption that the decline was roughly equal for both species in these areas. The 1976/77 Eden data suggested 75% or more of the greeneye dogshark catch in the southern area comprised S. mitsukurii and thus a relatively small proportion of Squalus grahami. However, in 1996 to 1997 no Squalus grahami were caught off Eden-Gabo Island suggesting that trawling to the north may be preventing recruitment of the species into southern NSW.

More than half of the known distribution of this species falls within the area of The Coral Sea Fishery (a Commonwealth managed fishery). This is a very small fishery, with only two operators in the trawl sector with extremely low effort, thus threats to this species from fishing activity in this area are thought to be minimal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently there are no conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eastern longnose spurdog

The eastern longnose spurdog, Squalus grahami, is a dogfish of the family Squalidae, found off northern Queensland, at depths of between 220 and 500 m. Its length is up to 64 cm.

Its reproduction is ovoviviparous.

See also[edit]

References[edit]

  1. ^ R. D. Cavanagh & T. J. Lisney (2003). "Squalus grahami". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved February 2, 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!