Overview

Distribution

Australia: souhern New South Wales to western South Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: Australia.
  • Last, P.R., W.T. White and H. Motomura 2007 Description of Squalus chloroculus sp. nov., a new spurdog from southern Australia, and the resurrection of S. montalbani Whitley. p. 55-69. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58441)   http://www.fishbase.org/references/FBRefSummary.php?id=58441&speccode=63581 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Eastern Indian Ocean and southwest Pacific: upper to mid continental slope off southern Australia from New South Wales (ca. 35°S) to the Great Australian Bight (33°S, 129°E).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

85.6 cm TL (male/unsexed; (Ref. 58441)); 83.2 cm TL (female)
  • Last, P.R., W.T. White and H. Motomura 2007 Description of Squalus chloroculus sp. nov., a new spurdog from southern Australia, and the resurrection of S. montalbani Whitley. p. 55-69. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58441)   http://www.fishbase.org/references/FBRefSummary.php?id=58441&speccode=63581 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This species of the ‘mitsukurii group’ is large and is distinguished by the following set of characters: body moderately robust, trunk depth 10.4-13.8% TL (mean 11.7% TL, n=9); snout is broadly triangular, with mouth width 1.72-2.48 (2.07) times the horizontal prenarial length; pre-first dorsal length 29.2-31.8 (30.2)% TL; pre-second dorsal length 60.7-63.6 (61.7)% TL; interdorsal space 23.7-27.5 (24.9)% TL; low raked dorsal fins; second dorsal-fin length 10.9-12.2 (11.6)% TL, height 3.4-4.0 (3.7)% TL, inner margin length 3.9-5.0 (4.4)% TL; second dorsal-fin base 15.1-20.0 (17.2) times the base of second dorsal spine; pre-pectoral length 21.1-24.3 (22.2)% TL; pelvic-caudal space 21.8-25.0 (23.5)% TL; caudal bar is almost upright, extending broadly from the caudal fork up the poster or margin of the upper lobe for 0.6-0.7 of its length in immature individuals, upper caudal fringe forming a narrow saddle along midlength of lobe; flank denticles tricuspid; monospondylous centra 43-46, precaudal centra 84-86, total centra 111-115 (Ref. 58441).
  • Last, P.R., W.T. White and H. Motomura 2007 Description of Squalus chloroculus sp. nov., a new spurdog from southern Australia, and the resurrection of S. montalbani Whitley. p. 55-69. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58441)   http://www.fishbase.org/references/FBRefSummary.php?id=58441&speccode=63581 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; marine; depth range 213 - 1360 m (Ref. 58441)
  • Last, P.R., W.T. White and H. Motomura 2007 Description of Squalus chloroculus sp. nov., a new spurdog from southern Australia, and the resurrection of S. montalbani Whitley. p. 55-69. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58441)   http://www.fishbase.org/references/FBRefSummary.php?id=58441&speccode=63581 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Found on upper to mid continental slopes at depths of 216–1,360 m (Last et al. 2007). Females and males reach at least 83.2 cm total length (TL) and 85.6 cm TL respectively (Last et al. 2007). Males mature by 68.5 cm TL (Last et al. 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Squalus chloroculus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATCTTTGGTGCATGAGCAGGTATAGTAGGTACCGCCCTTAGCTTACTTATTCGAGCAGAATTAAGCCAACCTGGTTCTCTTCTAGGAGATGATCAAATCTATAATGTTATCGTAACTGCTCACGCTTTTGTAATAATCTTTTTTATGGTTATGCCTGTAATAATTGGTGGATTCGGAAACTGATTAGTACCTTTAATGATTGGTGCACCAGACATAGCTTTTCCACGAATAAATAATATAAGCTTTTGATTATTGCCTCCCTCCCTCCTGTTACTTTTAGCCTCTGCTGGTGTAGAAGCGGGAGCCGGAACCGGCTGAACAGTCTACCCCCCTCTCGCAGGTAATATAGCTCATGCTGGAGCATCCGTAGACCTAGCCATCTTCTCACTCCATTTGGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATTACAACTATTATTAACATAAAACCACCTGCTATCTCTCAGTATCAAACACCGCTCTTTGTTTGATCCATCCTTGTAACCACAGTTCTTCTTCTTCTTTCTCTTCCTGTTCTCGCAGCCGCAATTACGATACTATTAACTGACCGTAATTTAAACACAACATTTTTTGATCCTGCTGGAGGGGGAGACCCAATTCTTTATCAACATTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Squalus chloroculus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Valenti, S.V., Stevens, J.D. & White, W.T.

Reviewer/s
Fowler, S.L. & Gibson, C.G. (Shark Red List Authority)

Contributor/s

Justification
The Greeneye Spurdog (Squalus chloroculus) is a large, recently described dogfish only known from New South Wales to the Great Australian Bight, southern Australia at depths of 216–1,360 m. This species was previously considered to be conspecific with Shortspine Spurdog (S. mitsukurii), however recent taxonomic work has revealed that the latter species does not occur in Australasian waters. Documented declines of approximately 97% of ‘Greeneye Dogsharks’ between 1976–77 and 1996–97 off central to southern New South Wales were reported from a fishery independent survey. Fishing pressure is intensive on these trawl grounds, where there is evidence that this species has been severely depleted. However, the rest of the species’ deepwater range throughout southern Australia to the Great Australian Bight is relatively lightly fished. The species’ depth range extends to 1,360 m depth, affording it refuge from fishing pressure at the lower extent of its range (particularly now that the fishery has been closed below 700 m). Thus S. chloroculus is assessed as Near Threatened globally, on the basis of an overall past decline in the total population estimated at 30–50%, reflecting its wider distribution outside the heavily fished area. Efforts should be made to monitor the population, particularly given the inherent biological vulnerability typical of Squalid sharks (three generation period may approach ~70 years). If fishing pressure increased further across this species range it would need to be re-evaluated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A recently described species (Last et al. 2007). The description provides details on the holotype and 14 additional specimens.

Documented declines of approximately 97% of ‘greeneye dogsharks’ between 1976-77 and 1996–97 between the Sydney area (central NSW) and the Eden-Gabo Island area (southern NSW/northern Victoria) were reported from a fishery independent survey (Graham et al. 2001). Total catches in the abovementioned areas at depths of 220 to 605 m declined from a mean of 44.8 kg/h in 1976/77 to a mean of 1.2 kg/h in 1996-97 (Graham et al. 2001). It is likely that Squalus chloroculus, S. montalbani and S. grahami were all caught during these surveys (K. Graham pers. comm. 2007). Squalus chloroculus was possibly the predominant species in the southern survey areas (Ulladulla and Eden-Gabo Island) (K. Graham pers. comm. 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Documented declines in fishery-independent scientific surveys for this species, and two other dogfishes, show that they are vulnerable to rapid population decline where they are heavily fished (see Population section above). Fishing pressure is intensive on trawl grounds around south-east Australia, where there is evidence that this species has been severely depleted. However the rest of the species’ deepwater range throughout southern Australia to the Great Australian Bight (representing about three quarters of the species’ total range) is relatively lightly fished, by comparison. The species’ depth range extends to 1,360 m depth, affording it some refuge from fishing pressure at the lower extent of its range (particularly now that the fishery has been closed below 700 m).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific measures in place for this species. The Australian Fisheries Management Authority (AFMA) has, however, introduced the following general measures for deepwater sharks within the Australian Southern and Eastern Scalefish and Shark Fishery (SESSF) in recent years, which may benefit this species:

Since 2003, vessels are required to land both the livers and carcasses of all dogfishes to enable accurate landing information to be recorded.

Since 2007, SESS Fishery was closed below 700 m to prevent targeting of deepwater species (750 m in Great Australian Bight Fishery) (See: http://www.mffc.gov.au/releases/2007/07005a.html).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!