Overview

Distribution

Range Description

This species was known as Squalus sp. B in Last and Stevens (1994). Found on the upper continental slope at depths from 240 to 450 m. Eastern Australia, from the upper continental slope between the Queensland Plateau off Cairns, to the Bermagui area, southern New South Wales. Range is currently uncertain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: eastern Australia.
  • Last, P.R., W.T. White and J.D. Stevens 2007 New species of Squalus of the 'highfin megalops group' from the Australasian region. p. 39-53. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58440)   http://www.fishbase.org/references/FBRefSummary.php?id=58440&speccode=63578 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

74.0 cm TL (male/unsexed; (Ref. 58440)); 86 cm TL (female)
  • Last, P.R., W.T. White and J.D. Stevens 2007 New species of Squalus of the 'highfin megalops group' from the Australasian region. p. 39-53. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58440)   http://www.fishbase.org/references/FBRefSummary.php?id=58440&speccode=63578 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This large species belonging to the 'highfin megalops group' has the following set of characters: abdomen depth 10.4-12.6% TL; pre-vent length 46.9-48.1% TL, 2.0-2.2 times dorsal caudal margin; pre-second dorsal length 3.7-4.3 times the pectoral-fin anterior margin, 2.5-2.8 times dorsal caudal margin; head width 1.0-1.4 times abdomen width; preoral length 2.9-3.1 times horizontal prenarial length, 8.4-9.1% TL; head length 4.3-4.9 times its eye length; mouth width 3.3-4.1 times length of upper labial furrow; interorbital width 1.5-1.7 times the horizontal preorbital length; fifth gill slit height 2.1-2.5% TL; strongly bifurcated anterior nasal flap; first dorsal fin upright, upper posterior margin directed posteroventrally, greatest concavity about midway between free rear tip and fin apex; posterior margin of second dorsal fin deeply concave; second dorsal-fin spine with a broad base; pectoral fin of adult not falcate, anterior margin long, 14.2-15.8% TL; dorsal surface dark, sharply demarcated from paler ventral surface on side of head; dorsal fins are dark with obvious darker tips; first dorsal-fin spine distinctly paler than the base of soft portion of dorsal fin; caudal fin with broad white posterior margin, caudal bar absent; flank denticles weakly tricuspid; monospondylous centra 44-46, precaudal centra 89-93, total centra 116-122 (Ref. 58440).
  • Last, P.R., W.T. White and J.D. Stevens 2007 New species of Squalus of the 'highfin megalops group' from the Australasian region. p. 39-53. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58440)   http://www.fishbase.org/references/FBRefSummary.php?id=58440&speccode=63578 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This medium-sized dogfish is either rare or uncommon, and its biology is virtually unknown. It attains at least 65 cm, the smallest mature male examined was 62 cm.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; marine; depth range 131 - 450 m (Ref. 58440)
  • Last, P.R., W.T. White and J.D. Stevens 2007 New species of Squalus of the 'highfin megalops group' from the Australasian region. p. 39-53. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58440)   http://www.fishbase.org/references/FBRefSummary.php?id=58440&speccode=63578 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Squalus sp. 2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squalus sp. 5

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squalus sp. 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Squalus sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTACCGCCCTTAGCTTACTTATTCGAGCAGAATTAAGCCAACCTGGTTCTCTTCTGGGAGATGATCAAATCTATAATGTTATCGTAACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTAATGCCTGTAATAATCGGTGGGTTCGGAAACTGATTAGTACCTTTAATGATTGGTGCGCCAGACATAGCTTTTCCACGAATAAATAATATAAGCTTTTGATTATTACCTCCCTCCCTCCTGTTACTTTTAGCCTCTGCTGGTGTAGAAGCGGGAGCCGGAACCGGCTGAACAGTATACCCCCCTCTCGCAGGTAATATAGCTCATGCTGGAGCATCCGTAGACCTAGCCATTTTCTCACTCCATTTGGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATTACAACTATTATTAACATAAAACCACCTGCTATTTCTCAGTATCAAACACCACTCTTTGTTTGATCCATCCTTGTAACCACAGTTCTTCTTCTTCTTTCTCTTCCTGTTCTCGCAGCCGCAATTACGATACTACTAACTGACCGTAATTTAAACACAACATTTTTTGATCCTGCTGGGGGAGGGGACCCAATTCTTTACCAACATTTANNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squalus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Squalus albifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTACCGCCCTTAGCTTACTTATTCGAGCAGAATTAAGCCAACCTGGTTCTCTTCTGGGAGATGATCAAATCTATAATGTTATCGTAACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTAATGCCTGTAATAATCGGTGGATTCGGAAACTGATTAGTACCTTTAATGATTGGTGCACCAGACATAGCTTTTCCACGAATAAATAATATAAGCTTTTGATTATTACCTCCCTCCCTCCTGTTACTTTTAGCCTCTGCTGGTGTAGAAGCAGGAGCCGGAACCGGCTGAACAGTATACCCCCCTCTCGCAGGTAATATAGCTCATGCTGGAGCATCCGTAGACCTAGCCATTTTCTCACTCCATTTGGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATTACAACTATTATTAACATAAAACCACCTGCTATTTCTCAGTATCAAACACCACTCTTTGTTTGATCCATCCTTGTAACCACAGTTCTTCTTCTTCTTTCTCTTCCTGTTCTCGCAGCCGCAATTACGATACTACTAACTGACCGTAATTTAAACACAACATTTTTTGATCCTGCTGGAGGAGGGGACCCAATTCTTTACCAACATTTANNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squalus albifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Squalus sp. zpl 00004

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCGCCCTT---AGCTTACTTATTCGAGCAGAATTAAGCCAGCCTGGAACACTCCTGGGAGAT---GATCAAATCTATAATGTTATCGTAACTGCTCACGCTTTTGTAATAATCTTTTTCATAGTTATGCCTGTAATAATCGGTGGATTCGGAAACTGATTAGTACCTTTAATA---ATTGGTGCACCAGACATAGCTTTTCCACGGATAAATAATATAAGCTTTTGATTGTTGCCCCCATCCCTCCTGCTACTCTTAGCCTCTGCTGGTGTAGAAGCAGGAGCCGGAACCGGCTGAACAGTTTACCCCCCGCTAGCAGGTAATATAGCCCATGCTGGCGCATCCGTAGACCTG---GCCATCTTCTCACTCCATTTAGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATCACAACTATTATTAACATAAAACCTCCTGCCATCTCTCAGTATCAAACACCACTCTTTGTTTGATCCATCCTTGTAACCACCGTTCTTCTTCTTCTTTCCCTCCCTGTCCTCGCAGCC---GCAATCACGATACTATTAACTGACCGTAATTTAAACACAACATTTTTTGATCCTGCTGGAGGAGGAGACCCAATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squalus sp. zpl 00004

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squalus albifrons (var)

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Lisney, T.J. & Cavanagh, R.D. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group (Shark Red List Authority)

Contributor/s

Justification
This dogfish occurs in eastern Australian waters. Its main known range is in an area with minimal fisheries although future expansion of deepsea trawl fisheries could pose a threat. The biology is virtually unknown though it is likely to have the limiting life history characteristics similar to other deepwater shark species. At present there is inadequate information to assess the conservation status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No data are available on population size or subpopulations.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is not thought to be abundant off central and southern New South Wales (NSW), and their occasional capture in the NSW trawl fishery is unlikely to have much impact on the main population which is presumably to the north (K. Graham pers. comm.). Future development of deepsea trawl fisheries in this area could pose a threat, as it is susceptible to being caught as bycatch.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently there are no conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eastern highfin spurdog

The eastern highfin spurdog, Squalus albifrons, is a dogfish which was described in 2007. It is a member of the family Squalidae, found on the continental shelf off Queensland, Australia, at depths of between 220 and 510 m. The length of the longest specimen measured is 65 centimetres (26 in).[2]

Its reproduction is ovoviviparous.

References[edit]

  1. ^ T. J. Lisney & R. D. Cavanagh (2003). "{{{title}}}". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved February 24, 2010. 
  2. ^ Leonard Compagno, Marc Dando & Sarah Fowler (2005). Sharks of the World. Princeton, New Jersey: Princeton University Press. ISBN 0-691-12072-2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!