Overview

Distribution

Range Description

This undescribed species is known as Apristurus sp. G in Last and Stevens (1994) and is represented in Australia by several populations which are distinct from each other and may be separate species. Their relationship to the similar western North Pacific catshark Apristurus herklotsi, has yet to be determined. Further research is required to resolve these taxonomic problems.

This widely distributed deep-water catshark is found along the Australian continental slope at depths of 590 to 1,000 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coasts of Australia: Queensland to Tasmania and to Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indian and Pacific coasts of Australia.
  • Sato, K., K. Nakaya and M. Yorozu 2008 Apristurus australis sp. Nov., a new long-snout catshark (Chondrichthyes: Carcharhiniformes: Scyliorhinidae) from Australia. In Last, P.R., White, W.T. & Pogonoski, J.J. (eds.): Descriptions of New Australian Chondrichthyans. CSIRO Marine and Atmospheric Research Paper no. 22. (Ref. 76943)   http://www.fishbase.org/references/FBRefSummary.php?id=76943&speccode=64107 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

61.6 cm TL (male/unsexed; (Ref. 76943))
  • Sato, K., K. Nakaya and M. Yorozu 2008 Apristurus australis sp. Nov., a new long-snout catshark (Chondrichthyes: Carcharhiniformes: Scyliorhinidae) from Australia. In Last, P.R., White, W.T. & Pogonoski, J.J. (eds.): Descriptions of New Australian Chondrichthyans. CSIRO Marine and Atmospheric Research Paper no. 22. (Ref. 76943)   http://www.fishbase.org/references/FBRefSummary.php?id=76943&speccode=64107 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This species has the following characters: flattened prenarial snout, apparently longer than interorbital width; furrows of upper labial much longer than the lower ones; pectoral fin widely expanding posteriorly, with outer margin a little longer than P1-P2 space; short abdomen, P1-P2 space narrower than preorbital length or anal fin base length; origin of first dorsal-fin just above or slightly anterior to pelvic-fin insertion; 50–64 and 48–68 tooth rows on upper and lower jaws, respectively; teeth with 5 or more cusps, including the anterior ones; egg capsule with no coiled tendrils on anterior and posterior ends, posterior end tapering toward tip; color preserved in alcohol is uniformly pale brownish to light greyish, sometimes light yellowish brown; the dorsal side of body is a little darker than ventral side (Ref. 76943).
  • Sato, K., K. Nakaya and M. Yorozu 2008 Apristurus australis sp. Nov., a new long-snout catshark (Chondrichthyes: Carcharhiniformes: Scyliorhinidae) from Australia. In Last, P.R., White, W.T. & Pogonoski, J.J. (eds.): Descriptions of New Australian Chondrichthyans. CSIRO Marine and Atmospheric Research Paper no. 22. (Ref. 76943)   http://www.fishbase.org/references/FBRefSummary.php?id=76943&speccode=64107 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This catshark reaches at least 61 cm with males maturing at about 51 cm. Biology is virtually unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 486 - 1035 m (Ref. 76943)
  • Sato, K., K. Nakaya and M. Yorozu 2008 Apristurus australis sp. Nov., a new long-snout catshark (Chondrichthyes: Carcharhiniformes: Scyliorhinidae) from Australia. In Last, P.R., White, W.T. & Pogonoski, J.J. (eds.): Descriptions of New Australian Chondrichthyans. CSIRO Marine and Atmospheric Research Paper no. 22. (Ref. 76943)   http://www.fishbase.org/references/FBRefSummary.php?id=76943&speccode=64107 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apristurus australis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATTTTTGGTGCATGGGCAGGCATAGTCGGAATAGCCTTGAGTTTATTAATCCGGGCAGAATTGGGCCAGCCTGGGTCCCTCTTAGGGGATGACCAGATCTACAATGTAGTCGTAACAGCCCATGCCTTCGTAATAATCTTTTTTATAGTTATGCCGGTAATAATTGGGGGCTTTGGAAACTGGCTCGTCCCTTTAATAATTGGTGCACCAGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGACTTCTTCCACCCTCTTTCTTACTCCTCCTAGCCTCCGCAGGAGTAGAGGCAGGGGCAGGAACAGGATGAACAGTTTACCCTCCTTTAGCAGGCAATCTAGCACACGCTGGCCCCTCTGTAGACCTGGCTATCTTCTCCCTCCATTTAGCCGGTATCTCGTCAATTTTAGCCTCAATTAACTTTATTACAACAATTATTAACATGAAACCACCAGCCATCTCTCAATACCAAACACCTTTATTTGTTTGATCAATCCTTATTACCACAGTTCTTCTTCTTCTTGCCCTCCCAGTTCTTGCAGCTGGAATTACAATATTACTCACAGACCGAAACCTCAATACCACCTTTTTTGACCCGGCAGGAGGGGGGGACCCAATCCTTTATCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apristurus australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Cavanagh, R.D. & Lisney, T.J. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Walker, T.I., Kyne, P.M. & Pogonoski, J. (Shark Red List Authority)

Contributor/s

Justification
This undescribed endemic belongs to a genus of poorly known deepwater catsharks. Very little is known of its biology. Possibly a widely distributed deep-water catshark found along the Australian continental slope at depths of 590 to 1,000 m, this consists of several distinct populations which may be separate species. Although part of the distribution includes heavily fished areas, particularly off southeastern Australia, much of its range is in unfished areas. Given the taxonomic uncertainty of the separate populations it is not possible to assess the conservation status of this species at this time. However, deepwater demersal trawl fisheries are expanding in the region, and the situation should be reassessed following taxonomic clarification.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no information on population size.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The wide distribution of this species includes some heavily fished areas, particularly off southeastern Australia by the South East Trawl Fishery (SETF) and South Tasman Rise Fishery, possibly the Great Australian Bight Trawl Fishery, and to a lesser extent off Western Australia. This species has not been recorded from the SETF, but this may be due to the similarity of this genus, resulting in all specimens being identified as Apristurus sp A. These catsharks are possibly quite rare (T.I.Walker, pers. comm.). Deepwater demersal trawl fisheries are expanding in the region. However, a significant proportion of its range receives only minor or no fishing pressure.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently there are no conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pinocchio catshark

The pinocchio catshark, Apristurus australis, is a species of fish in the Scyliorhinidae family found in Australia and possibly New Zealand. Its natural habitat is open seas. It belongs to a genus of poorly known deep-water sharks. Very little is known of its biology. Possibly a widely distributed deep-water catshark found along the Australian continental slope at depths of 590 to 1,000 m, it consists of several distinct populations which may be separate species. Although part of the distribution includes heavily fished areas, particularly off southeastern Australia, much of its range is in unfished areas. Given the taxonomic uncertainty of the separate populations, it is not possible to assess the conservation status of this species at this time. However, deep-water demersal trawl fisheries are expanding in the region, and the situation should be reassessed following taxonomic clarification.

References[edit]

  1. ^ R. D. Cavanagh & T. J. Lisney (2003). "Apristurus australis". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved February 7, 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!