Overview

Comprehensive Description

General Description

The shell is large, up to almost 200 mm long, and is elongate, and somewhat aduliform. The shell is rather thick and solid, with well-developed irregular growth lines on the external surface. The shell is a dull-whitish colour beneath the periostracum. The internal surface is nacreous-ivory. The beaks are subterminal, at about one-seventh the total shell length in adults. The umbones are very broad and flattened. The shell height gradually increases posteriorly, and the shell is markedly curved dorso-ventrally, and is most inflated at about the midlength. The valve length/ height ratio is 2.5-3.2, and the shell is equivalve. The anterior part of the shell is short and rather narrow, protruding nose-like anteriorly. The anterior margin is narrowly but evenly rounded, while the ventral margin is markedly concave over the anterior half. The posterior margin is evenly rounded ventrally and convex dorsally. The postero-dorsal angulation is well-defined, rounded, and is situated above the posterior adductor scar, close to the posterior margin. The prodissoconch is unknown. The periostracum is thick, hard, dark brown in colour. It is smooth and glossy to somewhat dull, with no periostracal hairs present (although the byssal endplates of other specimens are scattered over the valves). The hinge of adults is toothless, and the anterior hinge margin weakly protrudes ventrally. The ligament is opisthodetic and very strong, extending over about five-sixths of the postero-dorsal margin in front of the postero-dorsal corner and ending abruptly posteriorly. The ligament plate is weakly to strongly convex. There is a well-developed subligamental shell ridge that extends from under the umbo for about one-third of the ligament length. The primary ridge extends posteriorly behind the umbo, between the ligament and a secondary ridge, and becomes obsolete shortly before the posterior end of the ligament (visible only from a ventral perspective). The adductor scars are well defined. The anterior adductor scar is short, and is situated just in front of the umbo. The posterior adductor scar is rather large, more or less rounded, and is united with most of the posterior pedal and byssus retractor muscle complex. The anterior scar of this complex is well separated, very long and is divided itself into isolated impressions that extend posteriorly from under the middle of the ligament. The anterior byssus retractor muscle scar is situated deep under the beak on the anterior part of the umbonal cavity (visible only from a ventral perspective). The pallial line curves parallel to the ventral margin.

The ctenidia are long and narrow, about 75% of the shell length. The outer and inner demibranchs are of equal length, and the filaments are broad and fleshy. The ascending lamellae of the outer demibranch are anteriorly fused to the mantle for a very short distance, while those of the inner demibranch are fused to the visceral mass. There are no muscular longitudinal ridges on the mantle or visceral mass where the dorsal edges of the ascending lamellae attach, nor connection bars between the free edges and the gill axes. The inner mantle folds are separate along the entire ventral margin from the anterior adductor to the posterior margin. The mantle edges are slightly frilled over most of the length, but are more undulate along the posterior 30-50 mm. The edges terminate anteriorly over the anterior adductor, and are folded back directly onto the muscle and continue over it as a thin, delicate, inconspicuous membrane. The valvular siphonal membrane is short and thin, and without a median papilla. The foot-byssus retractor muscle complex is moderately elongate. The anterior retractor is rather short but very broad, and is inserted in the anterior part of the long umbonal cavity, with the most anterior point under the beaks. The posterior byssus retractor is composed of several diverging muscle bundles that have a common base at the base of the byssus. The anterior part is comprised of 3 bundles attached to a very long scar at about the middle of the valves, at about a right angle (anterior most bundle) and about 80° and 60° to the longitudinal shell axis (second and third bundle). The posterior bundle is comprised of 4-5 bundles that pass towards two attachment points, the most posterior bundle just before the posterior adductor. The posterior foot retractor is long and thin, and arises from the anterior side of the base of the foot behind the base of the anterior retractor muscles, passing parallel to the longitudinal shell axis towards the anterior bundle of the posterior byssus retractor, then bent dorsally to an attachment point, where it is closely appressed to the anterior bundle of the posterior byssus retractor. The foot is relatively small, measuring 35 mm long (including the byssal orifice) in a 167 mm specimen. There are two pairs of labial palps. The anterior pair is relatively small, while the posterior pair is long and narrow triangular in shape (measuring 7mm and 12-13 mm long respectively in a 160 mm specimen). The intestinal tract is narrow. The stomach is situated just behind the middle of the anterior half of the shell length, and is simple and thin-walled. The anterior chamber is ill-defined, while the posterior chamber is longer. There are 13 diverticular entrances, 7 in the anterior chamber and 6 in the posterior chamber. A depression on the posterior left side corresponds to the left pouch. The midgut runs posteriorly straight and medially from the stomach, under the ventricle. It enters the ventricle just in front of the ostia, without any loop or curve. Behind the heart, the intestine passes over the posterior adductor and ventrally on its posterior side. The anus is at the mid-diameter of the posterior adductor. The heart is rather broad, and is situated in the posterior half of the shell length, with the anterior extremity of the ventricle at the mid-shell/ mantle length. The auricles are long, and are fused posteriorly just in front of the posterior adductor. They stretch out forward in narrow lobes to the anterior bundle of the posterior retractor.

(Cosel & Marshall, 2003)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Off the southeastern North Island, New Zealand, living at 920-1,205 m (Cosel & Marshall, 2003).

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1530.5 - 1530.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathymodiolus tangaroa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGTGGTCGGGAATAATTGGTACAAGTTTGAGGATGCTGATTCGTATTGAATTAGCTCGTCCTGGGAGCTTTTTAGGTGAT---GATCAGCTTTATAATGTTATTGTAACTGCTCATGCATTGGTTATAATTTTTTTTATAGTTATGCCTTTGATGGTAGGCGGTTTTGGAAATTGGCTACTTCCTTTAATAATAGGTTCAATTGACATAATTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTTTTGCCGGCGTCTCTTTTTACTCTTTTGTTATCTACCTTTATTGAGAGAGGTGCTGGAACTGGTTGAACTTTGTACCCCCCTTTATCTTCTTATACTGGTCATAGGGGCCCAGCCGTGGATATGTCTTTATTTTCTTTACATTTAGCAGGTGCTTCTTCTATTGGGGGTTCAATTAATTTTCTGACGAGAATGAAGAATATGTCTGTTGAAAGAATGCGAGGGGAGCGGATAGTTTTGTTTGTTTGGTCCATGGCCGTAACAGCAGTTTTATTATTAGTTTCTTTACCTGTATTAGCAGGAGGAATTACTATGTTGATTTTTGACCGTCATTTTAATACTTCTTTTTATGACCCTAGGGGCGGAGGAGACCCAGTTTTATACCAGCATTTGTTTTGATTTTTTGGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bathymodiolus tangaroa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!