Ecology
Habitat
Depth range based on 5 specimens in 1 taxon.
Environmental ranges
Depth range (m): 1440 - 1606
Graphical representation
Depth range (m): 1440 - 1606
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 1440 - 1606
Graphical representation
Depth range (m): 1440 - 1606
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Vesicomya crenulomarginata
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGCGCTGGAGTTTTAGGTGAT---AGTCATTTGTATCAGGTAGTAGTTACGGCACATGGTTTATTAATAATTTTTTTTTTAGTAATACCAATAATGATTGGTGGTTTTGGAAATTGATTGGTACCTTTAATATTACAGATTCCTGATATAGCCTTTCCACGAATAAATAATTTAAGGTTTTGATTAATACCTAGATCAGTTTTAATGTTGCTAGGTTCTGCTTATGTAGAAAGTGGAGCAGGTACTGGTTGAACAATTTATCCTCCATTATCTAGTATTATAGGTCATGCTGGTCCGTCTGTAGATTTTGTAATTTTATCTTTACATTTAGGTGGAGTATCTTCTATTTTAGCATCTATTAATTTTGTAGTGACTTCTCTTTGTATGCGGGTTGAGGCTTTATCATTGTTGCGTGTAACTATGTTTGTTTGATGTGTTGCCGTTACTGGATTTTTATTAATTATTGCTATACCTGTTTTGGCTGGAAGATTAACAATGTTATTAACTGATCGTAAT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Vesicomya crenulomarginata
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
