Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysomya albiceps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGACAATGGTTATTTTCTACTAATCATAAAGATATTGGTACTTTATATTTCATTTTCGGAGCTTGATCTGGAATAGTAGGAACTTCTTTAAGAATTCTAATTCGAGCTGAATTAGGACATCCTGGAGCACTAATTGGAGAT---GACCAAATTTATAATGTAATTGTAACAGCTCATGCCTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTCTGACTTTTACCTCCTGCATTAACTTTACTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCACCTTTATCATCTAATATTGCTCATGGTGGAGCATCAGTTGATTTAGCTATTTTTTCTTTACACTTAGCTGGAATTTCATCAATTTTAGGAGCTGTAAATTTTATTACAACTGTTATTAATATACGATCTACAGGAATCACATTTGATCGAATACCTTTATTCGTATGATCTGTAGTTATTACTGCTCTTCTTTTATTATTATCATTACCAGTATTAGCCGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTCTTTGGACATCCAGAAGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATTATTAGTCAAGAATCAGGAAAAAAGGAAACATTTGGATCTTTAGGAATAATTTATGCAATATTAGCTATTGGTCTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGTAGGAATGGATGTAGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chrysomya albiceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chrysomya albiceps

Chrysomya albiceps is a species belonging to the blow fly family, Calliphoridae. It is of great medical and sanitary importance, being associated with myiasis in Africa and America although it plays a more significant role as a predator of other dipteran larvae.[1] The species is also of importance in forensic science and forensic entomology because it is the first insect to come in contact with carrion due to their ability to smell dead animal matter from up to ten miles (16 km) away.[citation needed] C. albiceps belongs to the same genus as the other myiasis-causing flies Chrysomya bezziana and Chrysomya putoria.

Taxonomy[edit]

Chrysomya albiceps is considered conspecific with Chrysomya rufifacies by some authorities.The two species have a similar biology and the morphological differences are slight (prostigmatic[2] bristle present in C. albiceps absent in C. rufifacies (but not all rufifacies so this character is unreliable)).There are minor differences in larval morphology.The taxonomy of C. rufifacies is therefore not completely clear, and its relation to C. albiceps has not been fully determined.[3]

References[edit]

  1. ^ [Margareth Maria de Carvalho Queiroz (1996). "Temperature Requirements of Chrysomya albiceps (Wiedemann, 1819) (Diptera, Calliphoridae) under Laboratory Conditions". Memórias do Instituto Oswaldo Cruz (Brazil) 91 (6): 785–788. doi:10.1590/S0074-02761996000600027. Retrieved 2009-04-18. 
  2. ^ File:Housefly anatomy-key.svg
  3. ^ Baumgartner, D. L. (1993). "Review of Chrysomya rufifacies (Diptera: Calliphoridae)". Journal of Medical Entomology 30 (2): 338–352. ISSN 0022-2585. PMID 8459410. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!