Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysomya megacephala

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 47 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBDP2900-07|AJ426041|Chrysomya megacephala| CGACAATGGTTATTTTCTACTAATCATAAAGATATTGGTACTTTATATTTCATTTTCGGAGCTTGATCCGGAATAGTAGGAACTTCATTA---AGTATTTTAATTCGAGCTGAATTAGGACACCCTGGAGCATTAATTGGAGAC---GACCAAATTTATAATGTAATTGTAACAGCTCACGCTTTTATTATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTAATG---TTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTCTGACTTTTACCTCCTGCATTAACTTTATTATTAGTAAGTAGTATAGTAGAAAATGGGGCTGGAACAGGATGAACTGTTTACCCACCTTTATCTTCTAATATTGCTCATGGAGGAGCATCAGTTGATTTA---GCTATTTTCTCTTTACACTTAGCAGGAATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCTACAGGAATTACATTTGATCGAATACCTTTATTTGTATGATCTGTAGTTATTACTGCTCTATTATTATTATTATCTTTACCAGTATTAGCTGGA---GCTATTACTATATTATTAACTGACCGAAATCTAAATACTTCATTCTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTCTTTGGACATCCTGAAGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATTATTAGTCAAGAATCAGGAAAAAAG---GAAACTTTCGGATCTTTAGGAATGATTTATGCTATACTAGCTATTGGTCTATTAGGATTTATTGTATGAGCTCACCACATGTTTACTGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chrysomya megacephala

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 43
Species: 80
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chrysomya megacephala

Chrysomya megacephala, more commonly known as the oriental latrine fly, is a warm-weather fly with a greenish-blue metallic box-like body which belongs to the family Calliphoridae (blowflies). This fly can be a nuisance to humans and even cause accidental myiasis.[1] C. megacephala contributes to the evolution of some insects, influences animal atmospheres, negatively alters human public health, and is a tool in forensic entomology.

Contents

Geographical distribution

Regions and areas found

C. megacephala stretches across vast regions of the world. It is particularly prevalent in the Oriental region and the Australasian region,[2] including the eastern coast of Queensland and New South Wales. It is found in Japan and Palearctic regions as well. Since the 1970s, C. megacephala has extended to different areas of the world, encroaching on the new territories of New Zealand and Africa[3] along with South, Central, and North America. C. megacephala began occupying the United States by means of harbors and airports.[4] The oriental latrine fly has been found in California[5] as well as Texas,[6] Louisiana,[7] and Hawaii.[8] C. megacephala consists of two forms, the normal and the derived. Tropical forests on the South Pacific islands, like Samoa, are home to the normal form; furthermore, normal is considered the plesiomorphic form of C. megacephala. The derived form is thought to have emerged from Papua New Guinea and is said to be synanthropic, ecologically associated with humans.

Ecology

C. megacephala prefers to live in climates that are warm most of the year. It has a long lifespan for a Dipteran, the warmer the temperature the longer the fecundity seems to be the correlation. In large densities of larva, where there are a lot of them in one small area competing for the same food source, the fecundity of the population is less. Where there is more food, there are larger adults and a bigger fecundity. A correlation between wing size and temperature and tibia size and temperature has been found in this species. As temperature increases then wing and tibia size increases. There was a similar relationship between wing and tibia size with fecundity. All three of these values, fecundity, wing size and tibia size are found to stay within the same range throughout the year, so a seasonal correlation seems to be absent. These laboratory findings are true of this species in a tropical environment, namely Brazil. Researchers have found this surprising since this fly is in high numbers in warm weather and low numbers in cold weather. They thought that the flies would be smaller during the warmer months because of other life tables constructed with other Dipteran species. The majority of Dipteran species that have had a life table constructed have demonstrated a tendency for smaller bodies in the warmer months. It has also been found that C. megacephala has a long lifespan as an adult and this, in part, has helped this species become so successful at invading so many geographical areas. The long lifespan of the adult allows the young to reach adulthood. The parents are there for the entire rearing of the offspring, ensuring survival.[9]

Life cycle

Development

Flies laying eggs on a dead baby bird.

This fly species is known to breed in human feces, meat, and fish. The developmental stages include egg, larvae, and pupa stages. When a female fly lays eggs there might be as much as 200 to 300 eggs total.[10] The larva stage includes a first, second, and third instar, or growth period within the larva stage.[11] C. megacephala eggs take approximately 100 days to develop while the larva will take 86 days and pupa 85 days.[12] Population numbers as well as body size are greatly influenced by temperature.[13] After completing all developmental stages, the C. megacephala life cycle consists of approximately 7 days.[14] Since C. megacephala has become forensically important, knowledge of development rates for these blowflies has become a necessity. C. megacephala development appears to be linked with the surrounding temperature and the length of time spent feeding in the larval stage. Development rate is mainly dependent on temperature, lower the temperature and larvae develop slower; raise the temperature and the larvae will develop faster.[15] Most studies conducted on developmental rate are done at 27°C. At this temperature eggs hatch-18 hrs, 1st molt-30hrs, 2nd molt-72hrs, pupation-144hrs, adult emerges-234hrs. It is also noted that these times can vary depending on geographical locations and other environmental factors can determine how long flies will stay in the larvae stage. Males tend to emerge only 2–3 hrs ahead of the females.[16]

Reproduction and survival rates

The factors involved in reproduction and survival rates of C. megacephala are closely related to the developmental factors. The amount of food is important in determining their survival and reproduction. Also, competition from other larvae species, such as C. rufifacies, is another factor in reproduction and survival.[17] When competing larvae are present, the amount of time spent feeding is shortened which leads to early pupation and smaller adults. This will then hasten the reproduction of C. megacephala. C. rufifacies is known to cannibalize maggot masses and thus a huge competitor.[18]

Appearance

C. megacephala’s appearance helps to determine the age of the species as well as to distinguish it from other species. Eggs are "oval with one flat face and another convex".[19] Adult flies reflect a metallic blue-green color on their thorax and abdomen and have very large red eyes on a large head. They have yellow gena, or cheeks.[20] Larvae vary in size according to which instar it exists in at any given time. Larvae shape is thicker towards the rear side and thins out near the head.[21] With all the problems that C. megacephala create, this group is one that needs to be recognized. C. megacephala are identified as having large red eyes with the males being close together and the females farther apart.[22] Also, the cercus of the male is longer than that of the female.[23]

Forensic science

Importance in forensic science

C. megacephala is considered one of the most important species of flies to forensic science. This is because it is one of the first species to show up on a corpse. A post mortem interval can be easily calculated when Chrysomya megacephala larva are found on a body because of their abundance. Most forensic entomology cases either have C. rufifacies or Chrysomya megacephala found on the decaying corpse in many areas of the world, and mitochondrial DNA is mainly used to determine subfamilies of Chrysomyinae.[24] Its wide geographical distribution and high fecundity allow it to be used in many forensic cases around the world. These cases are studied as a whole to find trends in insects collected off the bodies and from these studies it has been concretely concluded that C. megacephala is one of the most common blowflies found. The larval dispersion patterns of C. megacephala also make it a forensically important fly. To pupate, the larva move away from the food source to find a safe place to metamorphose. It is an important aspect for forensic entomologists to know so that they can accurately calculate a post mortem interval. Knowing to look under the body and in adjacent areas can be vital information for any case.[25]

Specific case studies

One study done in Thailand was used to compare and note what species of insects they found on 30 cases of cadavers. These 30 bodies were grouped into the specific environment they were found in urban-outdoor, urban-indoor, and forested area. C. megacephala was the most common fly found on these bodies, found on 20 bodies out of the 30 total. Calliphoridae was, by far, the most common family of flies found on all of these cadavers. Chrysomya megacephala was also found in more forested areas than C. rufifacies.[26]

Larval-state poisoning detection

In any part of the world that uses organophosphates, C. megacephala could prove to be beneficial. Organophosphate compounds are used in agriculture and are highly toxic.[27] Organophosphate poisoning often engenders death, and in many cases, by evaluating the body tissue and fluids, the toxin can be identified as the source of the poisoning. However, it is somewhat difficult to evaluate the body tissue in a body that is exceedingly decomposed. Nevertheless, a medical examiner in Hawaii worked a case in which malathion poisoning, an organophosphate insecticide,[28] was thought to be the cause death. The victim’s stomach content and body fat were examined and found to have contained malathion. The fly larvae of Chrysomya megacephala and Chrysomya rufifacies were also present at the scene on the body and were tested for malathion. Both of these species did contain malathion, but there had been no previous record of organophosphate in larvae. Studying larvae from decomposed remains may provide an effective method in determining these toxins on a body that is extremely decayed.[29]

Use in research other than forensics

C. megacephala has a beneficial and practical purpose apart from being significant to forensic investigations; this blowfly is the source of pollination for mango in the Australian region. While most areas wish to rid themselves of C. megacephala, Taiwan farmers have found ways in which to enhance the population of this blowfly so that more mangos will be pollinated.[30]

Larval competition

When C. megacephala is found on a body, C. rufifacies is not far behind. C. megacephala larvae are known to compete with C. rufifacies larvae for food in a mixed-species environment. Research has shown that under specific population densities C. rufifacies will facultatively feed on other species of maggots and its own species. When C. rufifacies and C. megacephala larvae are put into cultures separately from one another in high densities, C. megacephala has a higher rate of survival than C. rufifacies. C. rufifacies is known to cannibalize when food resources get low, but despite this apparent advantage it had a lower survival rate than C. megacephala. Both species had a lighter adult weight than normal and pupated earlier. The third instar of C. rufifacies will eat Chrysomya megacephala when the larvae are in high density. Despite predating on Chrysomya megacephala, both species had a lower survival rate, lighter adult weight and pupated early. This is helpful to know in court cases because it could affect the time of death estimation. If there is only C. rufifacies found on a body, it is not accurate to only use this species to calculate a time of colonization. The colonization of C. megacephala prior to C. rufifacies must be taken into account.[31]

Predators and prey

Chrysomya albiceps is also known to predate on C. megacephala during the larval stage when they must compete for the same food source.[32] Beetles are also known to predate on C. megacephala. C. megacephala is not predaceous in the adult or larval form, preferring to feed on necrophagous material of any kind such as fish, cows and humans.

Causing problems

Agricultural importance

C. megacephala causes myiasis in humans and animals. This causes losses in cattle and fish industries all over the world. Also, studies are being done on C. megacephala to determine its role as a vector for diarrhea-causing bacteria such as E-coli. Actual transmission has not been completely isolated but there are three theories on the way disease/bacteria are transmitted: through the flies’ saliva, feces, or externally.[17]

Public health importance and management control

Although this group can aid in pollination, C. megacephala can cause many problems as well. C. megacephala are known to be the source of accidental (secondary) myiasis in humans, meaning that these flies do not pierce the skin but invade an open wound.[33] In Thailand the first record of myiasis was that of a male, 53, where C. megacephala and C. rufifacies in their third instar accumulated within a tumor lesion in male’s right lower leg; however, of the myiasis cases that are recorded, most do not involve C. megacephala and C. rufifacies.[34] C. megacephala like filth and even lays its eggs on human feces, and after landing on the feces they will land on human food.;[35] this is how C. megacephala spreads disease, and it is a carrier of pathogens, such as bacteria, protozoan cysts, and helminth eggs, to human food.[27] Not only is this group a huge nuisance, it causes a huge economic problem in Asia, Africa, and the Pacific. In these areas sun-drying fish is a preservation method for sending the fish form where they are caught to the location of markets and consumers. Ice can be used to preserve the fish as well but, these areas are underdeveloped and often cannot afford this method. However, blowfly larvae tend to infect these sun-dried fish when the weather is warm and humid. An experiment was done to observe which flies show up around these sun-dried fish the most, and 95% were C. megacephala.[36] One technique to control this group is using an odor that the flies are attracted to, and then the flies can be trapped.[33] Also, insecticides can be used to handle the problem of Chrysomya megacephala, but sometimes resistance is built up to this control mechanism[37]

See also

References

  1. ^ Brundage, Adrienne. “Entomology”. Forensic Entomology Class Lecture. Texas A&M University, College Station. 2 Mar. 2009.
  2. ^ Wall Richard, and David Shearer. Veterinary Entomology: Arthropod Ectoparasites of Veterinary Importance . London: Springer, 1997.
  3. ^ Williams KA, Villet MH (2006). "A new and earlier record of Chrysomya megacephala in South Africa, with notes on another exotic species, Calliphora vicina (Diptera: Calliphoridae)" (PDF). African Invertebrates 47: 347–350. http://www.durban.gov.za/durban/discover/museums/nsm/pubs/recent-publications/Twilliams347-350.pdf. 
  4. ^ Williams KA, Villet MH (December 2006). "A new and earlier record of Chrysomya megacephala in South Africa" (PDF). African Invertebrates 47: 349. http://www.durban.gov.za/durban/discover/museums/nsm/pubs/recent-publications/Twilliams347-350.pdf. 
  5. ^ Gordoy WAC, et al. (September/October 1996). "Dynamics of Experimental Populations of Native and Introduced Blowflies (Diptera: Calliphoridae): Mathematical Modelling and the Transition from Asymptotic Equilibrium to Bounded Oscillations". Memorias do Instituto Oswaldo Cruz 91 (5): 639–40. PMID 9137751. http://memorias.ioc.fiocruz.br/915/3096.html. 
  6. ^ Wells JD (May 1991). "Chrysomya megacephala (Diptera: Calliphoridae) has reached the continental United States: review of its biology, pest status, and spread around the world". J. Med. Entomol. 28 (3): 471–3. PMID 1875378. 
  7. ^ Pharr, Lauren R. 2009. A Taphonomic Model of Concealment: Decomposition and the Postmortem Interval (PMI) in a 55-Gallon Barrel. M.A. thesis, Louisiana State University. http://etd.lsu.edu/docs/available/etd-07102009-110514/
  8. ^ Goff, M. Lee A Fly for the Prosecution: How Insect Evidence Helps Solve Crimes. Massachusetts: Harvard University Press, 2001.
  9. ^ Tomberlin JK, Reeves WK, Sheppard DC (2001). "First record of Chrysomya megacephala (Calliphoridae: Diptera) in Georgia, USA". Florida Entomologist 84 (2): 300–1. doi:10.2307/3496184. JSTOR 3496184. 
  10. ^ Doe, Peter E. “Fish Drying and Smoking” Production and Quality. CRC Press: 177, 179, 186. http://books.google.com/books?id=_eATME6TvigC&pg=PA177&dq=chrysomya+megacephala&ei=ApvBSaamK4XEzQTr_IDwCQ#PPR8,M1
  11. ^ M. Lee Goff. “A Fly for the Prosecution” How Insect Evidence Helps Solve Crimes. Pg. 40 http://books.google.com/books?id=DAa0BzT7Mf0C&pg=PA95&lpg=PA95&dq=chrysomya+megacephala+egg,+instars,+pupae,+adult&source=bl&ots=JwrByojFnw&sig=NogsHGe-UrdIEPzw3OQmlAgO6kg&hl=en&ei=tGDGSYfHDIrhtgfHmuzICg&sa=X&oi=book_result&resnum=3&ct=result#PPA40,M1
  12. ^ Refaat M. Gabre, Fatma K. Adham, Hsin Chi. (2005). "Life Table of Chrysomya mecagecephala (Fabricius) (Diptera: Calliphoridae". International Journal of Ecology, Acta Oecologica 27 (3): 179–183 see p. 180. doi:10.1016/j.actao.2004.12.002. http://140.120.197.173/Ecology/Papers/Gabre-paper.pdf. 
  13. ^ Regada C, Godoy WAC (2006). "Larval density, temperature and biological aspects of Chrysomya megacephala(Diptera: Calliphoridae)". Arq. Bras. Med. Vet. Zootec. 58 (4): 562–6. doi:10.1590/S0102-09352006000400018. http://www.scielo.br/pdf/abmvz/v58n4/a18v58n4.pdf. 
  14. ^ Doe, Peter E. “Fish Drying and Smoking” Production and Quality. CRC Press: 177, 179, 186. http://books.google.com/booksid=_eATME6TvigC&pg=PA177&dq=chrysomya+megacephala&ei=ApvBSaamK4XEzQTr_IDwCQ#PPR8,M1
  15. ^ Piangjai S, Siriwattanarungsee S, Sukontason KL, Sukontason K (2008). "Morphology and developmental rate of blowflies Chrysomya megacephala and Chrysomya rufifacies in Thailand: application in forensic entomology". Parasitol Res. 102 (6): 1207–16. doi:10.1007/s00436-008-0895-6. PMID 18264799. 
  16. ^ Kurahashi H, Wells JD (1994). "Chrysomya megacephala development: rate, variation and the implications for forensic entomology". Jpn. J. Sant. Zool 45 (4): 303–9. 
  17. ^ a b Bunchoo M, Khantawa B, Piangjai S, Rongsiyam Y, Sukontason KL, Sukontason K (2007). "Comparison between Musca dometica and Chrysomya megacephala as carriers of bacteria in northern Thailand". Southeast Asia J. Trop. Med. Public Health. 
  18. ^ Piangjai S, Siriwattanarungsee S, Sukontason KL, Sukontason K (2008). "Morphology and developmental rate of blowflies Chrysomya megacephala and Chrysomya rufifacies in Thailand: application in forensic entomology". Parasitol Res. 102 (6): 1207–16. doi:10.1007/s00436-008-0895-6. PMID 18264799. 
  19. ^ José Augusto de Oliveira David, Thalita Rocha, and Flávio Henrique Caetano. “Ultramorphological characteristics of Chrysomya megacephala (Diptera, Calliphoridae) eggs and its eclosion” (2008): http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T9N-4SSG4SC2&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=95615450a5f599ec430935bac55c1646
  20. ^ Jonathan A. Cammack. “A Survey of the Necrophilous Diptera on the Island of Dominica” Pg. 6 Department of Entomology at Texas A&M University, College Station, TX. http://dominica.tamu.edu/student%20projects/Dominica%20Projects%20pdf%20copy/Cammack_Jonathan.pdf
  21. ^ Jason H. Bryd, James L. Castner. “Forensic Entomology; The Utility of Arthropods in Legal Investigations” Pg. 33
  22. ^ Byrd, Jason H., and James L. Castner. Forensic Entomology. Florida: CRC Press, 2001.
  23. ^ Chaiwong, Tarinee; Sukontason, Kom; Olson, Jimmy K.; Kurahashi, Hiromu; Chaithong, Udom; Sukontason, Kabkaew L. (April 2008). "Fine structure of the reproductive system of Chrysomya megacephala". Parasitology Research 102 (5): 973–80. doi:10.1007/s00436-007-0863-6. PMID 18180955. http://www.ingentaconnect.com/content/klu/436/2008/00000102/00000005/00000863. 
  24. ^ Shiuh-Feng S, Yeh T (2008). "Larval competition of Chrysomya megacephala and Chrysomya rufifacies: behavior and ecological studies of two blow fly species of forensic significance". J. Med. Entomol. 45 (4): 785–799. doi:10.1603/0022-2585(2008)45[785:LCOCMA]2.0.CO;2. PMID 18714884. 
  25. ^ Byrd, James H. and James L. Castner. Forensice Entomology The Utility of Arthropods in Legal Investigations. CRC Press, New York. 2001.
  26. ^ Sukontason, Kom, Paitoon Narongchai, Chaturong Kanchai, Karnda Vichairat, Pongruk Sribanditmongkol, Tanin Bhoopat, Hiromu Kurahashi, Manoch Chockjamsai, Somsak Piangjai, Nophawan Bunchu, Somsak Vongvivach, Wirachai Samai, Tarinee Chaiwong, Rungkanta Methanitikorn, Rachadawan Ngern-Klun, Duanghatai Sripakdee, Worachote Boonsriwong, Sirisuda Siriwattanarungsee, Chaowakit Srimuangwong, Boonsak Hanterdsith, Khankam Chaiwan, Chalard Srisuwan, Surasak Upakut, Kittikhun Moopayak, Roy C. Vogtsberger, Jimmy K. Olson, and Kabkaew L. Sukontason (2007). "Forensic entomology cases in Thailand: a review of cases from 2000-2006". Parasitol Res 101 (5): 1417–23. doi:10.1007/s00436-007-0659-8. PMID 17647017. 
  27. ^ a b Wallman JF (1997). "First Record of the Oriental Latrine Fly, Chrysomya Megacephala, from South Australia" (PDF). Transaction of the Royal Society of S. Aust. 121 (4): 163–4. http://www.samuseum.sa.gov.au/Journals/TRSSA/TRSSA_v121/trssa_v121_p163p164.pdf. 
  28. ^ “Organophosphate Toxicity.” Department of Natural Resources. 2008. http://www.michigan.gov/dnr/0,1607,7-153-10370_12150_12220-27249--,00.html
  29. ^ Gunatilake, and Lee Goff (1989). "Detection of Organophosphate Poisoning in a Putrefying Body by Analyzing Arthropod Larvae". Journal of Forensic Sciences 34 (3): 714–6. PMID 2738573. http://www.astm.org/DIGITAL_LIBRARY/JOURNALS/FORENSIC/PAGES/JFS12698J.htm. 
  30. ^ Gabre RM, et al. (2005). "Life table of Chrysomya megacephala" (PDF). Acta Oecologica 27 (3): 179. doi:10.1016/j.actao.2004.12.002. http://140.120.197.173/Ecology/Papers/Gabre-paper.pdf. 
  31. ^ Shiao, Shiuh-Feng and Ta-Chuan Yeh (2008). "Larval Competition of Chrysomya megacephala and Chrysomya rufifacies (Diptera: Calliphoridae): Behavior and Ecological Studies of Two Blow Fly Species of Forensic Significance". J. Med. Entomol. 45. 
  32. ^ Gomes, Leonardo, Marcos Rogério Sanches and Claudio José Von Zuben. 2007. Behavior of the Combined Radial Post-feeding Larval Dispersal of the Blowflies Chrysomya megacephala and Chrysomya albiceps (Diptera, Calliphoridae)
  33. ^ a b Bunchu, Nophawan, et al. (2007). "Behavioral responses of Chrysomya megacephala to natural products". Parasitology Research 102 (3): 419–29. doi:10.1007/s00436-007-0780-8. PMID 18026752. http://parasitology.informatik.uni-wuerzburg.de/login/n/h/j_436-102-3-2007-11-17-780.html.html. 
  34. ^ Sukontason, Kabkaew L., et al. (2005). "First Report of Human Myiasis Caused by Chrysomya megacephala and Chrysomya rufifacies in Thailand, and Its Implication in Forensic Entomology" (PDF). J. Med. Entomol. 42 (4): 702–4. doi:10.1603/0022-2585(2005)042[0702:FROHMC]2.0.CO;2. PMID 16119563. http://www.med.cmu.ac.th/dept/parasite/KLS-PAPERPDF/LARVA/Firstmyiasis(JME).pdf. 
  35. ^ Hui, Yiu H. Handbook of Food Science, Technology, and Engineering. Florida: CRC Press, 2006.
  36. ^ Wall R, Howard JJ,Bindu J (April 2001). "The Seasonal Abundance of Blowflies Infesting Drying Fish in South-West India". Journal of Applied Ecology 38 (2): 339–348. doi:10.1046/j.1365-2664.2001.00588.x. JSTOR 2655802. 
  37. ^ Sripakdee, Duanghatai, et al. (2005). "Effect of Microwave Irradiation on the Blowfly Chrysomya Megacephala" (PDF). Chiang Mai University Research Note 36 (4): 893. http://www.tm.mahidol.ac.th/seameo/2005_36_4/12-3584.pdf. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!